ID: 1136893581

View in Genome Browser
Species Human (GRCh38)
Location 16:33983977-33983999
Sequence CGTGAGGGTGGTGGGCCTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136893562_1136893581 27 Left 1136893562 16:33983927-33983949 CCAAGAAAGGCTTCCCTGACACC No data
Right 1136893581 16:33983977-33983999 CGTGAGGGTGGTGGGCCTGCGGG No data
1136893560_1136893581 29 Left 1136893560 16:33983925-33983947 CCCCAAGAAAGGCTTCCCTGACA No data
Right 1136893581 16:33983977-33983999 CGTGAGGGTGGTGGGCCTGCGGG No data
1136893561_1136893581 28 Left 1136893561 16:33983926-33983948 CCCAAGAAAGGCTTCCCTGACAC No data
Right 1136893581 16:33983977-33983999 CGTGAGGGTGGTGGGCCTGCGGG No data
1136893565_1136893581 14 Left 1136893565 16:33983940-33983962 CCCTGACACCCGGACAGAGGCTG No data
Right 1136893581 16:33983977-33983999 CGTGAGGGTGGTGGGCCTGCGGG No data
1136893570_1136893581 6 Left 1136893570 16:33983948-33983970 CCCGGACAGAGGCTGGAGGGCTG No data
Right 1136893581 16:33983977-33983999 CGTGAGGGTGGTGGGCCTGCGGG No data
1136893571_1136893581 5 Left 1136893571 16:33983949-33983971 CCGGACAGAGGCTGGAGGGCTGG No data
Right 1136893581 16:33983977-33983999 CGTGAGGGTGGTGGGCCTGCGGG No data
1136893566_1136893581 13 Left 1136893566 16:33983941-33983963 CCTGACACCCGGACAGAGGCTGG No data
Right 1136893581 16:33983977-33983999 CGTGAGGGTGGTGGGCCTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136893581 Original CRISPR CGTGAGGGTGGTGGGCCTGC GGG Intergenic
No off target data available for this crispr