ID: 1136894415

View in Genome Browser
Species Human (GRCh38)
Location 16:33988404-33988426
Sequence ATGGACAAGAAGAAAGAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136894415_1136894421 4 Left 1136894415 16:33988404-33988426 CCTTACTCTTTCTTCTTGTCCAT No data
Right 1136894421 16:33988431-33988453 CCAACTACTGTAGCCTGGAAAGG No data
1136894415_1136894419 -1 Left 1136894415 16:33988404-33988426 CCTTACTCTTTCTTCTTGTCCAT No data
Right 1136894419 16:33988426-33988448 TGGGACCAACTACTGTAGCCTGG No data
1136894415_1136894424 27 Left 1136894415 16:33988404-33988426 CCTTACTCTTTCTTCTTGTCCAT No data
Right 1136894424 16:33988454-33988476 GACAGAAATCCCACAGCAGTAGG No data
1136894415_1136894422 5 Left 1136894415 16:33988404-33988426 CCTTACTCTTTCTTCTTGTCCAT No data
Right 1136894422 16:33988432-33988454 CAACTACTGTAGCCTGGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136894415 Original CRISPR ATGGACAAGAAGAAAGAGTA AGG (reversed) Intergenic
No off target data available for this crispr