ID: 1136898598

View in Genome Browser
Species Human (GRCh38)
Location 16:34013269-34013291
Sequence TGAGATGCCATTTCCTGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136898598_1136898604 10 Left 1136898598 16:34013269-34013291 CCCTGGCAGGAAATGGCATCTCA No data
Right 1136898604 16:34013302-34013324 CCTGTTCTGCAGAGGTAGGGAGG No data
1136898598_1136898601 6 Left 1136898598 16:34013269-34013291 CCCTGGCAGGAAATGGCATCTCA No data
Right 1136898601 16:34013298-34013320 CTTTCCTGTTCTGCAGAGGTAGG No data
1136898598_1136898602 7 Left 1136898598 16:34013269-34013291 CCCTGGCAGGAAATGGCATCTCA No data
Right 1136898602 16:34013299-34013321 TTTCCTGTTCTGCAGAGGTAGGG No data
1136898598_1136898600 2 Left 1136898598 16:34013269-34013291 CCCTGGCAGGAAATGGCATCTCA No data
Right 1136898600 16:34013294-34013316 CACACTTTCCTGTTCTGCAGAGG No data
1136898598_1136898605 11 Left 1136898598 16:34013269-34013291 CCCTGGCAGGAAATGGCATCTCA No data
Right 1136898605 16:34013303-34013325 CTGTTCTGCAGAGGTAGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136898598 Original CRISPR TGAGATGCCATTTCCTGCCA GGG (reversed) Intergenic
No off target data available for this crispr