ID: 1136898604

View in Genome Browser
Species Human (GRCh38)
Location 16:34013302-34013324
Sequence CCTGTTCTGCAGAGGTAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136898599_1136898604 9 Left 1136898599 16:34013270-34013292 CCTGGCAGGAAATGGCATCTCAG No data
Right 1136898604 16:34013302-34013324 CCTGTTCTGCAGAGGTAGGGAGG No data
1136898598_1136898604 10 Left 1136898598 16:34013269-34013291 CCCTGGCAGGAAATGGCATCTCA No data
Right 1136898604 16:34013302-34013324 CCTGTTCTGCAGAGGTAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136898604 Original CRISPR CCTGTTCTGCAGAGGTAGGG AGG Intergenic
No off target data available for this crispr