ID: 1136902491

View in Genome Browser
Species Human (GRCh38)
Location 16:34053291-34053313
Sequence TTTTCTTAAATTTGAAACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136902491_1136902497 3 Left 1136902491 16:34053291-34053313 CCTGTGTTTCAAATTTAAGAAAA No data
Right 1136902497 16:34053317-34053339 GGGAAGCGTAATGCAAAATGCGG No data
1136902491_1136902498 23 Left 1136902491 16:34053291-34053313 CCTGTGTTTCAAATTTAAGAAAA No data
Right 1136902498 16:34053337-34053359 CGGACTATGCCAGCTATGATTGG No data
1136902491_1136902499 24 Left 1136902491 16:34053291-34053313 CCTGTGTTTCAAATTTAAGAAAA No data
Right 1136902499 16:34053338-34053360 GGACTATGCCAGCTATGATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136902491 Original CRISPR TTTTCTTAAATTTGAAACAC AGG (reversed) Intergenic