ID: 1136902497

View in Genome Browser
Species Human (GRCh38)
Location 16:34053317-34053339
Sequence GGGAAGCGTAATGCAAAATG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136902491_1136902497 3 Left 1136902491 16:34053291-34053313 CCTGTGTTTCAAATTTAAGAAAA No data
Right 1136902497 16:34053317-34053339 GGGAAGCGTAATGCAAAATGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136902497 Original CRISPR GGGAAGCGTAATGCAAAATG CGG Intergenic
No off target data available for this crispr