ID: 1136908089 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:34120469-34120491 |
| Sequence | TCCACATGGTCCTCAACTGC CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1136908089_1136908090 | -10 | Left | 1136908089 | 16:34120469-34120491 | CCGGCAGTTGAGGACCATGTGGA | No data | ||
| Right | 1136908090 | 16:34120482-34120504 | ACCATGTGGAGAACCACTACTGG | 0: 1 1: 5 2: 2 3: 7 4: 77 |
||||
| 1136908089_1136908094 | 21 | Left | 1136908089 | 16:34120469-34120491 | CCGGCAGTTGAGGACCATGTGGA | No data | ||
| Right | 1136908094 | 16:34120513-34120535 | TCCCAACCTGAGAGCAGAACAGG | 0: 1 1: 3 2: 2 3: 14 4: 153 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1136908089 | Original CRISPR | TCCACATGGTCCTCAACTGC CGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||