ID: 1136908089

View in Genome Browser
Species Human (GRCh38)
Location 16:34120469-34120491
Sequence TCCACATGGTCCTCAACTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136908089_1136908090 -10 Left 1136908089 16:34120469-34120491 CCGGCAGTTGAGGACCATGTGGA No data
Right 1136908090 16:34120482-34120504 ACCATGTGGAGAACCACTACTGG 0: 1
1: 5
2: 2
3: 7
4: 77
1136908089_1136908094 21 Left 1136908089 16:34120469-34120491 CCGGCAGTTGAGGACCATGTGGA No data
Right 1136908094 16:34120513-34120535 TCCCAACCTGAGAGCAGAACAGG 0: 1
1: 3
2: 2
3: 14
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136908089 Original CRISPR TCCACATGGTCCTCAACTGC CGG (reversed) Intergenic
No off target data available for this crispr