ID: 1136908090

View in Genome Browser
Species Human (GRCh38)
Location 16:34120482-34120504
Sequence ACCATGTGGAGAACCACTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 5, 2: 2, 3: 7, 4: 77}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136908089_1136908090 -10 Left 1136908089 16:34120469-34120491 CCGGCAGTTGAGGACCATGTGGA No data
Right 1136908090 16:34120482-34120504 ACCATGTGGAGAACCACTACTGG 0: 1
1: 5
2: 2
3: 7
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136908090 Original CRISPR ACCATGTGGAGAACCACTAC TGG Intergenic
902471391 1:16649231-16649253 ACCAGGAGGAGAAGCACTGCCGG - Intergenic
902487418 1:16758214-16758236 ACCAGGAGGAGAAGCACTGCCGG + Intronic
903408856 1:23122920-23122942 GCCTTGTGTAGAACCACAACTGG + Intronic
905295947 1:36954487-36954509 AGCATGTGGGGAGCCACTCCAGG + Intronic
912970646 1:114279177-114279199 ACCATGTGGAGAAACACTACTGG - Intergenic
916036345 1:160925946-160925968 CCCATGTGGATAACTACCACTGG + Intergenic
921536605 1:216357017-216357039 ACCATGTCCAGAAACACTAAAGG - Intronic
922678763 1:227572419-227572441 ACCATGCAGAGAACCACTACTGG - Intronic
1064309163 10:14196834-14196856 ACCATTTAGAGAACTACGACTGG - Intronic
1064722039 10:18238768-18238790 ACAATGTGGAAAATTACTACAGG + Intronic
1072154517 10:92712534-92712556 ACAATGTGGAGAACTTCAACAGG - Intergenic
1077401641 11:2361105-2361127 GCCAGGTACAGAACCACTACCGG + Intergenic
1086267192 11:85014753-85014775 ACCATTTGTAGAACCAATACAGG - Intronic
1093150836 12:15619080-15619102 ACTGAGTGAAGAACCACTACTGG - Intergenic
1094036194 12:26074682-26074704 AACATGTTAAGAACCACTAGAGG + Intronic
1096534765 12:52264260-52264282 ACCATGTGCACAACCAGGACTGG + Intronic
1109308916 13:60669927-60669949 TCCATGTGTAGAACCACTTAAGG + Intergenic
1109405611 13:61894284-61894306 AACATATGGAGAACCACAAGAGG + Intergenic
1117404601 14:55389937-55389959 ACAATGTGGAGACTCACTAAGGG + Intronic
1118685334 14:68285106-68285128 AGCATGGGGAAAACCACTCCAGG + Intronic
1120898108 14:89552521-89552543 ACCATGTGGAGACACCCTCCAGG - Intronic
1121087912 14:91160652-91160674 CCCATATGGAGAACCACCAGTGG + Intronic
1128088311 15:64901236-64901258 ACCATGTGGGGAATCCCTACAGG + Intronic
1136908090 16:34120482-34120504 ACCATGTGGAGAACCACTACTGG + Intergenic
1137814840 16:51388735-51388757 GCCAGGGTGAGAACCACTACAGG - Intergenic
1138317331 16:56081465-56081487 CCCAGGTAGAGAACCACTAGGGG - Intergenic
1144154430 17:12485392-12485414 ACCATCTGGAGAATGACTACTGG + Intergenic
1147281483 17:39364755-39364777 ATCATGTGGAGAACAAGAACTGG + Intronic
1148617920 17:49014185-49014207 ACCGCGGGGAGAACCACTAACGG - Intronic
1159652705 18:70996542-70996564 ACCATGGGGAAAACCACCCCCGG - Intergenic
1202703789 1_KI270713v1_random:6026-6048 ACCAGGAGGAGAAGCACTGCCGG - Intergenic
925754928 2:7124210-7124232 ACCATTTGAAGAACAACTTCTGG + Intergenic
927725506 2:25419370-25419392 ACCATGGGGAGAACCGCTGGGGG + Intronic
928069671 2:28202132-28202154 ACCAGATGGAAAACCACTACTGG + Intronic
930917194 2:56707400-56707422 ATCATGGGGAGAATCACTAAGGG - Intergenic
937223912 2:120357335-120357357 ACCCAGTGGGGAACCACTCCAGG + Intergenic
941948314 2:171124810-171124832 AGCCTGTGCAGAACAACTACAGG - Intronic
944627156 2:201582842-201582864 ACCATCAGGAGAAACACTGCAGG - Intronic
948163714 2:235845039-235845061 GCCATGTGGAGCCCCACTGCTGG - Intronic
1171814913 20:29777676-29777698 ACCGTGTGGAGAACCACTGCTGG - Intergenic
1171903523 20:30879046-30879068 ACCATGTGGAGAACAACTACTGG + Intergenic
1177800513 21:25824326-25824348 ACCCTGTAGAGAACGACAACAGG + Intergenic
1180318352 22:11298226-11298248 ACCGTGTGGAGAACCACTACTGG - Intergenic
1181086572 22:20442259-20442281 ACGATGTGGAGAAGGACTGCTGG - Exonic
952187599 3:30987105-30987127 ACCATGAGAAGAACCATGACTGG + Intergenic
953934521 3:47028847-47028869 GTCATCTGGAGAACCACTACTGG + Intronic
954298040 3:49685010-49685032 ACCAGGAGGAGAAGCACTGCCGG + Exonic
955577248 3:60379103-60379125 ACTATGAGGAGAACCGCTAAAGG + Intronic
959470062 3:106739103-106739125 ACCACATGGAGACCCACTGCAGG + Intergenic
961114059 3:124313771-124313793 ACCAAGTTGAAAATCACTACTGG + Intronic
968903468 4:3441600-3441622 TCCATGATGAGAGCCACTACGGG - Intergenic
971497493 4:27282636-27282658 ATCATGTGGAGCACCACCATAGG - Intergenic
973977861 4:56281095-56281117 CCCAGGTGGTGAACCAGTACCGG + Intronic
978344876 4:107756601-107756623 CCCTCGTGGAGAACCTCTACTGG + Intergenic
980322216 4:131293196-131293218 ACCATGTTAAGAACCATTGCTGG + Intergenic
982186662 4:152808895-152808917 ACCATGTGGTGAAACACCACGGG - Intronic
993442958 5:87978828-87978850 TCCTTATGGAGAACCTCTACTGG + Intergenic
993854593 5:93057541-93057563 ACCCTGTGGAGAACCACAGAAGG + Intergenic
994208576 5:97062589-97062611 ACCCTGTGGACAACCATTCCTGG - Intergenic
996025759 5:118644082-118644104 ACAGTGTGGAGAACCTCTAAAGG + Intergenic
996249893 5:121316917-121316939 GCCTGGTTGAGAACCACTACTGG + Intergenic
997003740 5:129793932-129793954 AGCATGTGAAGTACCTCTACAGG - Intergenic
997311083 5:132883464-132883486 ACCACTTGCAGAAGCACTACTGG + Exonic
999731036 5:154476891-154476913 TCCATGGGGAGAACCAGAACTGG + Intronic
1001696855 5:173676540-173676562 ACCATGAGGAGAACAACTTGAGG - Intergenic
1008221464 6:48859207-48859229 ACCATATGGATGACCACTAATGG - Intergenic
1009032121 6:58072246-58072268 ACCATCTGCAGAAACACTACCGG + Intergenic
1010175340 6:73021401-73021423 TACATGTGGAGAATCACTGCTGG - Intronic
1018704017 6:166450168-166450190 ACCATGGGGACCACCACAACAGG + Intronic
1019842893 7:3466107-3466129 ACCATGTGGAGCAGGACTGCTGG + Intronic
1020016157 7:4833378-4833400 ACGATGTGGACACACACTACAGG + Intronic
1020849758 7:13337163-13337185 AGCATGTGCAGAACTACTCCAGG + Intergenic
1024926316 7:54619061-54619083 CCCTTATGGAGAACCTCTACTGG - Intergenic
1030629269 7:111878080-111878102 AACATGTTGAGCAACACTACAGG + Intronic
1031241765 7:119253179-119253201 ACCAGGTGATGAAACACTACTGG - Intergenic
1031349133 7:120706991-120707013 ACCATGTGTAGTACTATTACAGG + Intronic
1036959349 8:13226891-13226913 ACCATGTTTAGAACCACTTGAGG - Intronic
1037546353 8:19927716-19927738 AGCATGTGGAGAATGACTAGGGG + Intronic
1038791550 8:30672522-30672544 ACCAGGTAAAGAACCACGACCGG + Intergenic
1043052107 8:75396985-75397007 GCCAGGAGGAGAACCACCACCGG - Intergenic
1045863446 8:106838997-106839019 ACCATGTGAAGAACTATTAAGGG + Intergenic
1052803035 9:32987758-32987780 ACCATGTGGAGAACCTGGCCAGG + Exonic
1055247886 9:74268762-74268784 AGCATGTGTGGAAACACTACAGG + Intergenic
1058212443 9:102186212-102186234 TCCATGTGGAGTTCCCCTACTGG - Intergenic
1060141386 9:121213297-121213319 ACTATGGGGAAAACCACTTCCGG + Intronic
1203366581 Un_KI270442v1:263988-264010 ACCGTGTGGAGAACCACTACTGG - Intergenic
1185963020 X:4566347-4566369 AACATGTGGAGAACTACCATCGG - Intergenic
1189760039 X:44312651-44312673 AATAGGTGGAGAACCACTTCTGG - Exonic
1190439129 X:50459536-50459558 GCCATGAAGAGAACCACTAATGG + Intronic
1196685613 X:118507901-118507923 ACCATGTGAAGAAATACTAGAGG + Intronic
1197214226 X:123853147-123853169 ACCAAGTGAAAAACCACTGCAGG + Intergenic
1201072096 Y:10156239-10156261 ACGATGTGGAGAACCACTACTGG + Intergenic