ID: 1136908094

View in Genome Browser
Species Human (GRCh38)
Location 16:34120513-34120535
Sequence TCCCAACCTGAGAGCAGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 3, 2: 2, 3: 14, 4: 153}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136908089_1136908094 21 Left 1136908089 16:34120469-34120491 CCGGCAGTTGAGGACCATGTGGA No data
Right 1136908094 16:34120513-34120535 TCCCAACCTGAGAGCAGAACAGG 0: 1
1: 3
2: 2
3: 14
4: 153
1136908091_1136908094 7 Left 1136908091 16:34120483-34120505 CCATGTGGAGAACCACTACTGGC No data
Right 1136908094 16:34120513-34120535 TCCCAACCTGAGAGCAGAACAGG 0: 1
1: 3
2: 2
3: 14
4: 153
1136908092_1136908094 -5 Left 1136908092 16:34120495-34120517 CCACTACTGGCCAAGCATTCCCA No data
Right 1136908094 16:34120513-34120535 TCCCAACCTGAGAGCAGAACAGG 0: 1
1: 3
2: 2
3: 14
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136908094 Original CRISPR TCCCAACCTGAGAGCAGAAC AGG Intergenic
905018898 1:34795064-34795086 TCTCATCCAGTGAGCAGAACTGG + Exonic
906586517 1:46983715-46983737 TCCCAGCCTGAGGGCAGTAGAGG + Intergenic
907160010 1:52362740-52362762 GCCCCATCTGAGAGCAGAGCAGG + Exonic
907666730 1:56439522-56439544 TGCCACTCTAAGAGCAGAACAGG + Intergenic
908033404 1:60026111-60026133 CACCAACCTGAGAACTGAACTGG - Intronic
909691269 1:78410073-78410095 TCCCAACCAGTGAGAAGAAATGG - Intronic
911626271 1:100128293-100128315 TCCCAAAGTGATAGCAGTACAGG + Intronic
912755084 1:112317654-112317676 TACCTAACTGAGAGCCGAACAGG - Intergenic
916453892 1:164950531-164950553 TCAGAAACTGAGAGAAGAACTGG + Intergenic
917976606 1:180243930-180243952 ACCCAACCTGAGAGCTCAAGGGG - Intronic
920282838 1:204857353-204857375 TCCCAACCTAAGAGAAGACAAGG - Intronic
920386666 1:205574869-205574891 TCCCAACCTCAGAGTCTAACAGG + Intronic
922078251 1:222268954-222268976 TCCCCATTTGAGAGCAGACCAGG - Intergenic
922679136 1:227576377-227576399 TCCCAACCAAAAAGCAGCACAGG - Intronic
924451939 1:244186639-244186661 TCCTAACCTGAGAGGAAAAAAGG - Intergenic
1063973519 10:11397604-11397626 TCCCAAAATCAGAGCAGAAAGGG + Intergenic
1070490507 10:76971494-76971516 GCCCAAACTGACAGCAGAATAGG - Intronic
1071110310 10:82147993-82148015 TCACAAGCTGTGAGCAGCACTGG + Intronic
1071334576 10:84590263-84590285 CCCCACCCTGAGATCAGAGCAGG - Intergenic
1072727547 10:97823891-97823913 CCCCAGCCTGAGACCAGAGCAGG - Intergenic
1074345125 10:112677628-112677650 TTCCCACCTGAAAGCAGAGCAGG + Intronic
1075426315 10:122344367-122344389 ACCCAACATGAAACCAGAACTGG + Intergenic
1075496738 10:122927793-122927815 TCCCAGCCTGGGAGCAGAGAGGG + Intergenic
1076193541 10:128499317-128499339 TCCCATCCTGTGTGCTGAACAGG + Intergenic
1076312917 10:129521113-129521135 TCCCCACCTGAGATCAGAACTGG - Intronic
1076500679 10:130933784-130933806 TCTCCTCCTGAGAGCAGAGCTGG + Intergenic
1076772202 10:132671888-132671910 TCCCCTTCTGAGAGCAGAGCAGG - Intronic
1078581326 11:12541719-12541741 TGCCTCCCTGAGACCAGAACGGG + Intergenic
1078792604 11:14559536-14559558 ACACAACCAGAGAGCAGAAGGGG + Intronic
1082770859 11:57206486-57206508 TCCAGGCCTGAGAGCAGAGCAGG + Intergenic
1084479800 11:69413266-69413288 TACCAATCTGTGAGCAAAACAGG + Intergenic
1085692401 11:78674372-78674394 TCCCAACCTGAGATTGGGACGGG - Intronic
1088486639 11:110347217-110347239 TCCCACCCTTAGAACAGAAAAGG + Intergenic
1092659183 12:10721346-10721368 TCCCAATCTCAGAACAGTACAGG + Intronic
1092687004 12:11059761-11059783 CCTTAACCTGAGAACAGAACAGG + Intronic
1092689377 12:11089954-11089976 TCTTAACCTGAGACCGGAACAGG + Intronic
1092692731 12:11131782-11131804 TCTTAACCTGAGACCAGAACAGG + Intronic
1095422505 12:42040000-42040022 TCCTAACCTGGGAGCAGAGGAGG + Intergenic
1097313141 12:58143163-58143185 TCACTCCCTGAGAGCAGAAATGG - Intergenic
1098362558 12:69668923-69668945 TCCCATCCTGAGGGCAAAAATGG - Intronic
1104184685 12:126419191-126419213 TCTCTAGCTGAGAGCAGAAGAGG + Intergenic
1107820395 13:44280752-44280774 TCTCCTCCTGAGAGCACAACAGG - Intergenic
1110008152 13:70297553-70297575 TCCCACTCTGAGATCAGAGCAGG - Intergenic
1113826799 13:113261682-113261704 TCTCTACCCGAGAGCAGAGCAGG - Intronic
1120202613 14:81554042-81554064 TCCTAGCCGGAGAGGAGAACAGG - Intergenic
1122924031 14:104891675-104891697 TCCAGGCCTGAGAGCAGAAGGGG + Intronic
1125781528 15:42273462-42273484 TCCCGCCCTTAGAGCAGAGCCGG - Exonic
1128494777 15:68190172-68190194 TACCAACCTAAGAGAAGAACAGG + Exonic
1128941291 15:71790057-71790079 TCTCACCCTGACAGCAGAAGTGG + Intergenic
1131394280 15:92074466-92074488 GGCCCACCTGAGACCAGAACTGG - Intronic
1131586536 15:93701620-93701642 TCCCTCCCAGAGAGAAGAACGGG + Intergenic
1132468605 16:89419-89441 CCCCAGCCTGGGAGCAGAGCAGG - Intronic
1132591640 16:728691-728713 TGCCCACCTGAGGGCAGACCGGG + Intronic
1132792505 16:1699653-1699675 TTCCAACATGAGATCAGATCAGG - Exonic
1136908094 16:34120513-34120535 TCCCAACCTGAGAGCAGAACAGG + Intergenic
1138262045 16:55630847-55630869 TACCCACCTGAGAACAGAATAGG - Intergenic
1139507686 16:67407348-67407370 TCCCACCATGAGCGCAGAGCTGG - Intronic
1139847327 16:69930143-69930165 TCCCATCCTGGGGGCAGAGCTGG - Exonic
1142020242 16:87777778-87777800 TCCCAACCTCTGCGCAGCACTGG - Intergenic
1146086061 17:29830785-29830807 TACCAAGAGGAGAGCAGAACTGG - Intronic
1147326470 17:39672142-39672164 TCTCAACCAGACAGCAGCACAGG + Exonic
1147383756 17:40070367-40070389 TCCATACCTGAGAATAGAACAGG + Intronic
1147687525 17:42295615-42295637 TCCCAGCCGGAGAGCTGCACTGG - Exonic
1148844896 17:50523872-50523894 TCCCAGCCTAAGAGGAGAATTGG + Intronic
1150342454 17:64379478-64379500 TCCAAACTTCAGAGCAGACCAGG + Intronic
1152901477 17:82943519-82943541 TCCCCACCTGAGAGCAGGCCAGG - Intronic
1155637875 18:27976431-27976453 TCCCATCCTTGAAGCAGAACTGG - Intronic
1158539626 18:58341065-58341087 TCCCAGCCTGAAGGCAGACCCGG - Exonic
1160946559 19:1646496-1646518 ACCCAAGCTGGGAGCAGAGCTGG + Intronic
1161357358 19:3826374-3826396 TCCCCACCTGAGAGCAGGGAGGG - Intronic
1162345775 19:10117183-10117205 TCCCTCCCTGAGCCCAGAACTGG - Exonic
1164801322 19:31079140-31079162 TCAAAACCTAAGAGCAGAAAGGG - Intergenic
1166133212 19:40759407-40759429 TACCAAACAGAGAGCAGAACGGG - Intronic
1166553354 19:43681799-43681821 TGCCAACCTGAGAGGTGAAAAGG - Intergenic
1168603475 19:57739226-57739248 TCTCAACCTCAGAGCAGAACTGG - Intronic
928662511 2:33517582-33517604 TCACAACCTCAGAGCAGAAAAGG + Intronic
928891653 2:36211278-36211300 GCCCCAGCTCAGAGCAGAACTGG - Intergenic
933709673 2:85315982-85316004 TCTCCACCTGAGGGCAGAAAGGG - Intergenic
933713395 2:85343792-85343814 TCTCCACCTGAGGGCAGAAAGGG + Exonic
941367235 2:164622678-164622700 TCCCAACCTGTGAGGAAACCTGG + Intergenic
946011146 2:216564473-216564495 GCCCAACCTGGGACCACAACAGG - Intronic
1169572887 20:6925811-6925833 TCCCATCCTAAGAGTAGAAGAGG - Intergenic
1171814909 20:29777645-29777667 TCCCAACCTGACAGCAGAACAGG - Intergenic
1171903526 20:30879077-30879099 TCCCAACCTGACAGCAGAACAGG + Intergenic
1172378783 20:34470105-34470127 TACTAACCTGACACCAGAACCGG - Exonic
1174057898 20:47811092-47811114 CCCTAAACTGAGAGCAGAAAGGG + Intergenic
1174160380 20:48546222-48546244 CCCTAAACTGAGAGCAGAAAGGG - Intergenic
1175857709 20:62131570-62131592 TCTCAACCTGAGGGCAGAGCTGG + Intronic
1176146572 20:63568166-63568188 TCCTCACCTGACAGCAGACCCGG + Intronic
1176368560 21:6048870-6048892 TCCCCACATGAGACCAGAGCGGG - Intergenic
1179634125 21:42696552-42696574 TCCCACCATGAGAGCAGCCCTGG - Intronic
1179754959 21:43489672-43489694 TCCCCACATGAGACCAGAGCGGG + Intergenic
1180336921 22:11585036-11585058 TCCCAACCTGACAGCAGAACAGG + Intergenic
1181620812 22:24090007-24090029 TGCCATCCTCAGAGCAGAATAGG - Intronic
1181952596 22:26565217-26565239 TTCAAACCTGAGAGCGGTACAGG + Intronic
954789104 3:53117684-53117706 TGACACCCTGAGAGCAGAGCTGG - Intronic
956514306 3:70029493-70029515 TCCCAAACTGGGAGCATTACAGG - Intergenic
961994394 3:131226223-131226245 TCCCTACTTGATGGCAGAACTGG + Intronic
964267499 3:154915554-154915576 TCACAACCTGAAATCAGCACTGG - Intergenic
967681028 3:192364028-192364050 TCCCAACCTTCAGGCAGAACTGG - Intronic
968984424 4:3867369-3867391 TCCCACCCTGAGACCAGCCCAGG - Intergenic
970046826 4:11863634-11863656 TCACAGCCTGAAAGCAGACCAGG + Intergenic
971015601 4:22485879-22485901 AGCCAGACTGAGAGCAGAACTGG + Intronic
972671077 4:41214509-41214531 TTCCTACTTGAGACCAGAACGGG + Exonic
973563661 4:52162459-52162481 CCCCAACCAGAGAGAAGAATTGG - Intergenic
974983030 4:68985099-68985121 GCACAACCAGAGAGCAGTACTGG + Intergenic
974994338 4:69134694-69134716 GCACAACCAGAGAGCAGTACTGG - Intronic
975017504 4:69441026-69441048 GCACAACCAGAGAGCAGTACTGG - Intergenic
976281198 4:83328646-83328668 TGCCATCATGAGGGCAGAACAGG + Intronic
988825077 5:34928291-34928313 TCCCCTCCTGAGAACAGAATTGG - Intergenic
989382388 5:40822220-40822242 TACCATCCTGGGAGCAGAAATGG - Intergenic
993375660 5:87147162-87147184 AACCAAGATGAGAGCAGAACTGG - Intergenic
994839035 5:104897504-104897526 TTCCAACCTGAGAGATGAACTGG + Intergenic
996923028 5:128790823-128790845 TCCTAAGCTGAGAGGAGAAGGGG + Intronic
997006607 5:129824288-129824310 TACCAAAATCAGAGCAGAACTGG + Intergenic
997382154 5:133445630-133445652 TACCAAGCTGAGAGCAGACTGGG + Intronic
997434296 5:133863221-133863243 TCCCAAACTGTGAAAAGAACTGG + Intergenic
998135435 5:139671781-139671803 CCCCAAGCCGAGAGCTGAACTGG + Intronic
999633298 5:153593854-153593876 TGCCAAAATGAGAGCATAACTGG - Intronic
1001297395 5:170507839-170507861 TCCCAAACAGAGAGAAGGACAGG - Intronic
1003137460 6:3444709-3444731 TTCCAACCTGAAAACAAAACAGG - Intronic
1003317508 6:5025686-5025708 TCCAAGACTGAGATCAGAACAGG - Intergenic
1003365362 6:5469309-5469331 TCACTACCTCACAGCAGAACCGG + Intronic
1009324941 6:62338361-62338383 CCCCAGCCTGAGAGCAGTAGGGG - Intergenic
1011132333 6:84064395-84064417 TCCCAAGCACAGAGCAGGACAGG + Intronic
1011542479 6:88447030-88447052 TCTGCAGCTGAGAGCAGAACAGG + Intergenic
1011748495 6:90432213-90432235 ACCCAACCTGAGGGGAGAAGGGG - Intergenic
1012408199 6:98924894-98924916 TTCTAGCCTGAGAGCAGATCAGG - Intronic
1020079877 7:5281702-5281724 TCCCAGCTTGGGATCAGAACTGG - Intronic
1020079880 7:5281712-5281734 TCCCAAGCTGGGAGGAGAAAGGG + Intronic
1023608657 7:41952948-41952970 TGCCAACCTGACACCAGAAGTGG - Intergenic
1023652648 7:42388042-42388064 TCCCATCCTGAGTCCAGAACTGG + Intergenic
1025199032 7:56950504-56950526 TCCCAAGCTGGGAGGAGAAAGGG - Intergenic
1025199035 7:56950514-56950536 TCCCAGCTTGGGATCAGAACTGG + Intergenic
1025672912 7:63626419-63626441 TCCCAGCTTGGGATCAGAACTGG - Intergenic
1025672915 7:63626429-63626451 TCCCAAGCTGGGAGGAGAAAGGG + Intergenic
1031544915 7:123039454-123039476 TCCCCACTGGAGAGCAGAAGAGG + Intergenic
1033472595 7:141663400-141663422 TGCCAACCTGAGAGCTGTATGGG - Intronic
1034548826 7:151807515-151807537 TCCCAACCTACGAGCTGAAATGG + Intronic
1034729566 7:153374490-153374512 TCCCAAACTGAGAGGATAAATGG + Intergenic
1037274167 8:17159421-17159443 TCCCTAGCTGAGAGCAGATGTGG - Intronic
1037313471 8:17579394-17579416 TGCCAATCTGAGACCAGCACTGG - Intronic
1038013037 8:23489888-23489910 TCCTAAGCTGGGAGGAGAACAGG - Intergenic
1038591948 8:28847261-28847283 TCCTAACCTGACAGCATAACAGG - Intronic
1039041262 8:33410847-33410869 CTGCAACCTGAAAGCAGAACTGG + Intronic
1041263684 8:56043887-56043909 GACCAACCTGAGAGAAGAACAGG + Intergenic
1043266078 8:78268868-78268890 TCACAACCTCAGAGCAGAGTTGG + Intergenic
1045785207 8:105912835-105912857 TCCCTTCCTGTGAGCAGAGCAGG - Intergenic
1046255733 8:111694320-111694342 TCCCAACCTGAGGGCAGTTAGGG + Intergenic
1047252641 8:123192348-123192370 TCCCCAGCTGAGAGGAGAACTGG - Intronic
1047701549 8:127454091-127454113 TCCCAATCAGAAAGCAGCACTGG - Intergenic
1050276846 9:4009490-4009512 TTCCCACCAGAGAGCAGAACTGG + Intronic
1053460100 9:38262048-38262070 CACCATCCTGAGAACAGAACGGG + Intergenic
1054842729 9:69760411-69760433 TCCCAGCCTGAGAGATGAAGAGG + Intergenic
1056683245 9:88738149-88738171 TCCCATCCTGAGTGCTGTACTGG - Intergenic
1057353105 9:94316667-94316689 TCCCCAGCTGAGGGCACAACAGG - Intergenic
1057441859 9:95089196-95089218 TTCCAGCCTGAGAGCAAACCGGG + Intergenic
1057654640 9:96940924-96940946 TCCCCAGCTGAGGGCACAACAGG + Intronic
1061758453 9:132832923-132832945 TCCCCAGCTCAGAGCAGACCTGG - Intronic
1062171393 9:135136809-135136831 TCTCAGCCTGAGAACAGCACGGG - Intergenic
1187247186 X:17563371-17563393 GCCTCACCTGAGACCAGAACAGG + Intronic
1187648467 X:21374817-21374839 ACCCCACCTGAGAGCAGCTCGGG + Intronic
1187914074 X:24136504-24136526 TCCCAAATTGAGAACAAAACAGG - Intergenic
1188111474 X:26199350-26199372 TGTCAACTTCAGAGCAGAACAGG + Intergenic
1188485920 X:30682133-30682155 TACCAACCTGAGAGAAAAAATGG + Intronic
1191728469 X:64306927-64306949 CCCCAGCATGAGAGCAGATCAGG + Intronic
1192691873 X:73373251-73373273 TCCCACCCTGTGAGGAGAATTGG + Intergenic
1193792322 X:85830367-85830389 TCTCAATCTGAGAGCAGGAAAGG - Intergenic
1194494557 X:94596626-94596648 TCTCAAACTGACAGGAGAACAGG - Intergenic
1198968116 X:142249719-142249741 GCCCACCCTGAGCACAGAACAGG - Intergenic
1200012554 X:153130009-153130031 TCCTAACCTAAGAGCATAACTGG + Intergenic
1200027045 X:153269906-153269928 TCCTAACCTAAGAGCATAACTGG - Intergenic
1200674580 Y:6135143-6135165 CCCCAGCCTGAGAGCAGCAGGGG - Intergenic