ID: 1136910679

View in Genome Browser
Species Human (GRCh38)
Location 16:34141882-34141904
Sequence GGCTCACGAAAGCCCCATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136910670_1136910679 16 Left 1136910670 16:34141843-34141865 CCTGGCTGGGCTGGAGCGGGGGG No data
Right 1136910679 16:34141882-34141904 GGCTCACGAAAGCCCCATGTGGG No data
1136910664_1136910679 25 Left 1136910664 16:34141834-34141856 CCTGCGCAGCCTGGCTGGGCTGG No data
Right 1136910679 16:34141882-34141904 GGCTCACGAAAGCCCCATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136910679 Original CRISPR GGCTCACGAAAGCCCCATGT GGG Intergenic
No off target data available for this crispr