ID: 1136910767

View in Genome Browser
Species Human (GRCh38)
Location 16:34142520-34142542
Sequence GGCTCACGAAAGCCCCATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136910767_1136910775 16 Left 1136910767 16:34142520-34142542 CCCACATGGGGCTTTCGTGAGCC No data
Right 1136910775 16:34142559-34142581 TCCCCCTCTCCAGCCCAGCCAGG 0: 1
1: 1
2: 12
3: 98
4: 1537
1136910767_1136910781 25 Left 1136910767 16:34142520-34142542 CCCACATGGGGCTTTCGTGAGCC No data
Right 1136910781 16:34142568-34142590 CCAGCCCAGCCAGGCTGCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136910767 Original CRISPR GGCTCACGAAAGCCCCATGT GGG (reversed) Intergenic
No off target data available for this crispr