ID: 1136910775

View in Genome Browser
Species Human (GRCh38)
Location 16:34142559-34142581
Sequence TCCCCCTCTCCAGCCCAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1649
Summary {0: 1, 1: 1, 2: 12, 3: 98, 4: 1537}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136910773_1136910775 -5 Left 1136910773 16:34142541-34142563 CCAGGGAGCAAGGGCCTCTCCCC 0: 1
1: 0
2: 6
3: 35
4: 368
Right 1136910775 16:34142559-34142581 TCCCCCTCTCCAGCCCAGCCAGG 0: 1
1: 1
2: 12
3: 98
4: 1537
1136910768_1136910775 15 Left 1136910768 16:34142521-34142543 CCACATGGGGCTTTCGTGAGCCA No data
Right 1136910775 16:34142559-34142581 TCCCCCTCTCCAGCCCAGCCAGG 0: 1
1: 1
2: 12
3: 98
4: 1537
1136910766_1136910775 27 Left 1136910766 16:34142509-34142531 CCTGGGGCTCTCCCACATGGGGC No data
Right 1136910775 16:34142559-34142581 TCCCCCTCTCCAGCCCAGCCAGG 0: 1
1: 1
2: 12
3: 98
4: 1537
1136910767_1136910775 16 Left 1136910767 16:34142520-34142542 CCCACATGGGGCTTTCGTGAGCC No data
Right 1136910775 16:34142559-34142581 TCCCCCTCTCCAGCCCAGCCAGG 0: 1
1: 1
2: 12
3: 98
4: 1537

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136910775 Original CRISPR TCCCCCTCTCCAGCCCAGCC AGG Intergenic
900095621 1:938962-938984 GCCCCTGCTCCAGCTCAGCCTGG - Intronic
900123965 1:1061429-1061451 TCCCCGGCTCCAGCCCACCCTGG - Intergenic
900175877 1:1291155-1291177 GCCCCCGCTCTAGCCCAGGCAGG - Intronic
900210983 1:1455778-1455800 TCTTCCTCGGCAGCCCAGCCTGG + Exonic
900381584 1:2386855-2386877 TCCCTCTACCCAGCCAAGCCAGG - Intronic
900617185 1:3570780-3570802 GCCCCCTCCACCGCCCAGCCTGG + Intronic
900647876 1:3717254-3717276 ACCCCCGCACCAGCCCTGCCAGG + Intronic
900733081 1:4275770-4275792 TCCCCCTGGCCAGTCCAGCTGGG - Intergenic
900886005 1:5415835-5415857 TCTCCCTCTGCAGGCCAGCCTGG + Intergenic
901068523 1:6506080-6506102 TCCCCAGCTCCAGCTCGGCCAGG + Intronic
901196746 1:7444512-7444534 TCTCTGCCTCCAGCCCAGCCTGG - Intronic
901306844 1:8239096-8239118 TCTCCCTCTGCTGCCCAGGCTGG + Intergenic
901317798 1:8320608-8320630 TCCCTCTATCTAGCCCAGGCTGG - Intronic
901481217 1:9526620-9526642 TCTCGCTCTATAGCCCAGCCAGG - Intergenic
901496582 1:9625906-9625928 CCCTCCTCTCCACCCCTGCCAGG - Intergenic
901663424 1:10813134-10813156 GCCCCACCTCCAGCCCAGCATGG - Intergenic
901670938 1:10856136-10856158 TCCCCCTCCCTCGCCCAGGCTGG - Intergenic
901852067 1:12022082-12022104 CCCCTCTCTCCAGTCAAGCCTGG + Exonic
901909756 1:12446807-12446829 TCCCAATCTCCACCCCAGTCTGG + Intronic
901964126 1:12852155-12852177 TGCACCTCTGCAGTCCAGCCTGG + Intronic
902041267 1:13494031-13494053 TCTCCCTCTCTTGCCCAGGCTGG - Intronic
902218623 1:14950425-14950447 TGACCCTCTCAGGCCCAGCCTGG - Intronic
902432090 1:16371233-16371255 TTCCCCACTGCACCCCAGCCTGG - Intronic
902565960 1:17311552-17311574 TCGCTCTGTCCAGCCCAGGCTGG + Intronic
902618069 1:17634739-17634761 TCCTCCACACCAGCTCAGCCAGG - Intronic
902715999 1:18273073-18273095 TCCCCCTCTGTTGCCCAGGCTGG + Intronic
902721497 1:18307235-18307257 TCCTCCTCCCCAACCCTGCCAGG + Intronic
902770431 1:18642720-18642742 CCCCCTGCTCCACCCCAGCCGGG - Intronic
902784417 1:18723806-18723828 TCCCTCTCTCCCCCTCAGCCAGG - Intronic
902792527 1:18778776-18778798 TCCCACCTTCCTGCCCAGCCCGG - Intergenic
902833376 1:19032263-19032285 CATCGCTCTCCAGCCCAGCCCGG - Intergenic
902955560 1:19922442-19922464 GCCCCTGGTCCAGCCCAGCCTGG - Intronic
902989043 1:20173270-20173292 TGAGCCTCTCCACCCCAGCCTGG + Intronic
902996562 1:20230016-20230038 TCCCCCACTACACTCCAGCCTGG + Intergenic
903071489 1:20729025-20729047 CCCCACCGTCCAGCCCAGCCAGG + Intronic
903076288 1:20769512-20769534 TGCACCTCTGCACCCCAGCCTGG + Intronic
903185885 1:21628856-21628878 TCTCCCTCTGGAGCCCAGGCTGG - Intronic
903338131 1:22638299-22638321 TCCCCCTCCCCAGCCCCTTCAGG + Intronic
903393714 1:22983371-22983393 TCTCCCTCTCTTGCCCAGGCTGG + Intergenic
903464336 1:23541696-23541718 TCTCACTCTGCAGCCCAGGCTGG + Intergenic
903468214 1:23567440-23567462 TCCCACTCTGCTGCCCAGGCTGG + Intergenic
903602869 1:24555212-24555234 TCTCACTCTGCAGCCCAGGCTGG - Intergenic
903734928 1:25523927-25523949 ACCCCCTGGCCAGCCCAGGCAGG + Intergenic
903940842 1:26930194-26930216 TCTCGCTCTGCTGCCCAGCCTGG + Intronic
904004489 1:27356743-27356765 TCCACCTCTGCAGCCCAGTGCGG + Exonic
904029917 1:27527694-27527716 CTCCCCTCCCCAGCCAAGCCTGG + Intergenic
904145951 1:28391367-28391389 TCTCCCTCTGTAGCCCAGGCTGG - Intronic
904204071 1:28841315-28841337 GGCCCATCCCCAGCCCAGCCCGG + Intronic
904480616 1:30791139-30791161 TCTCTCTCTGCAGGCCAGCCTGG + Intergenic
904641911 1:31937848-31937870 TCCCCCGCCCCGGCCCGGCCCGG + Intronic
904716115 1:32468829-32468851 TCTCCCTCTCTCGCCCAGGCTGG - Intronic
904748386 1:32725387-32725409 TCACCCTCCCTGGCCCAGCCTGG - Intergenic
905028104 1:34865207-34865229 TCCCCCTCTTCACCCCACCTGGG + Intergenic
905117947 1:35658823-35658845 TCTCCCTCTGTAGCCCAGGCCGG - Intergenic
905308008 1:37032588-37032610 TAACCCTTTGCAGCCCAGCCTGG - Intronic
905579250 1:39071082-39071104 TCCACCACTGCACCCCAGCCTGG - Intergenic
905734117 1:40314595-40314617 TCACCCTCTCCAGCCCGGCCAGG - Intronic
905893970 1:41533462-41533484 TCCCTCTTTCCTGCACAGCCCGG + Intronic
905990988 1:42336653-42336675 TCCTGCTCTCCCGCCCAGGCTGG + Intergenic
906031947 1:42728273-42728295 TGCCCCACTCCATTCCAGCCTGG - Intergenic
906213400 1:44024733-44024755 TCCCCATCCTCACCCCAGCCAGG + Intronic
906214344 1:44030410-44030432 CCCCACTCTCCCGCCCGGCCCGG + Intronic
906215480 1:44035851-44035873 TCCTCCAGTCCAGCCCAACCCGG + Intergenic
906325018 1:44840130-44840152 TCTCCCTCTGCTGCCCAGGCTGG + Intronic
906385904 1:45368416-45368438 TGCGCCACTGCAGCCCAGCCTGG - Intronic
906429241 1:45741656-45741678 TCCCGCTCTTTAGCCCAGGCCGG + Intronic
907369211 1:53988907-53988929 TCCACCACTGCACCCCAGCCTGG - Intergenic
907405844 1:54252936-54252958 TCCCCCACAGCAGCACAGCCTGG - Intronic
907538952 1:55194570-55194592 TCTCCCTCTGTCGCCCAGCCTGG - Intronic
908062546 1:60367685-60367707 TCCTGCTCTCCAGCCCACCCCGG - Intergenic
908497636 1:64710926-64710948 TCCCGCTCTTTAGCCCAGGCCGG + Intergenic
908703863 1:66930178-66930200 CCCTCCAGTCCAGCCCAGCCGGG + Intronic
909108838 1:71448567-71448589 TCTCCCTCTCTCGCCCAGGCTGG - Intronic
909252954 1:73381548-73381570 CCCCCATCTCCTGCCCACCCAGG + Intergenic
909420870 1:75463388-75463410 TCCCGCTCTTTAGCCCAGGCTGG - Intronic
910074198 1:83258081-83258103 TCTCACTCTATAGCCCAGCCTGG - Intergenic
910486841 1:87724067-87724089 TTCCCCTCTCCAACCCATCCAGG - Intergenic
910712517 1:90196329-90196351 CCCCACTCTCCAACACAGCCAGG - Intergenic
910888375 1:91990825-91990847 TCTCACTCTCTTGCCCAGCCTGG + Intronic
910983492 1:92981917-92981939 TCTCCCTCTCTCGCCCAGGCTGG + Intergenic
910989595 1:93041458-93041480 TCCCTCTCTCTCGCCCAGGCTGG + Intergenic
911064927 1:93779801-93779823 TACCCACCTCCAGCCCAGCAGGG + Intronic
911107839 1:94150852-94150874 TCCCGCTCTTTAGCCCAGGCCGG - Intronic
911200466 1:95038746-95038768 TCTCCCTCTCTTGCCCAGGCTGG + Intronic
911453657 1:98096544-98096566 TCTCCCTCTGCTGCCCAGACTGG + Intergenic
911969178 1:104408403-104408425 TCCCCCCATCAAGCCCAGGCAGG + Intergenic
912095627 1:106138864-106138886 TCTCGCTCTGCAGCCCAGGCTGG - Intergenic
912212711 1:107572202-107572224 TCCCCCTCTGCAGCCCATCCTGG - Exonic
912318698 1:108690361-108690383 TCCCACTCTCTGGCCCAGGCTGG - Intergenic
912424234 1:109572278-109572300 TCCCGCTCTGTAGCCCAGGCTGG - Intronic
912501004 1:110121800-110121822 CCCCTCCCTGCAGCCCAGCCTGG + Intergenic
912505443 1:110152592-110152614 TCTCCCTGCCCAGCCCAGCCTGG - Intronic
912546114 1:110452946-110452968 TGCCTGTCTCCAGCCCAGCAAGG - Intronic
912682775 1:111739510-111739532 TCCGCCTCGGCCGCCCAGCCCGG - Intronic
912939007 1:114028732-114028754 TCTCACTCTCCTGCCCAGGCTGG + Intergenic
913066565 1:115261230-115261252 TGCCCCTAGCCAGGCCAGCCTGG + Intergenic
913249113 1:116897162-116897184 TCTCCCTCTGTAGCCCAGGCTGG - Intergenic
914239641 1:145845019-145845041 TCTCACTCTACAGCCCAGACAGG - Intergenic
914345199 1:146793117-146793139 TCTCCATCTCCAACACAGCCTGG - Intergenic
914699331 1:150117169-150117191 TCGCCCTCTGTAGCCCAGGCTGG - Intronic
914867602 1:151445011-151445033 TCCAGCTCTCCAGCTCAGGCTGG - Intronic
915099345 1:153487597-153487619 TCCCACTCTGCTGCCCAGGCTGG - Intergenic
915119537 1:153620255-153620277 TCCCACTCTGTAGCCCAGACTGG - Intronic
915165576 1:153946262-153946284 TCCCCGCCTGCCGCCCAGCCCGG + Intronic
915170471 1:153973743-153973765 TCCCCCTCCCTTGCTCAGCCAGG - Intronic
915575708 1:156775216-156775238 CCTCCCTCTGCAGCCCAGGCTGG - Intronic
915622505 1:157094412-157094434 TTTCCCTCTCCAACCCTGCCAGG + Intronic
915905423 1:159873350-159873372 CCCCCTTCTCCTACCCAGCCAGG + Intronic
915912140 1:159922093-159922115 TCCCCCTCTCCCACACACCCAGG + Intronic
917304009 1:173608721-173608743 TCTGCCTCTCCTGCCCAGGCTGG - Intergenic
917321010 1:173781342-173781364 TCCCACTCTGCTGCCCAGGCTGG + Intronic
917566355 1:176215998-176216020 TCCCACTCTCTTGCCCAGGCTGG - Intergenic
917974273 1:180229466-180229488 TCCCCTTCCCCAGCCCGGGCCGG + Intergenic
918339932 1:183559827-183559849 TCCCCCTCTGTTGCCCAGGCTGG - Intronic
918356858 1:183713053-183713075 TCTCCCTCTCTCGCCCAGGCTGG + Intronic
918512391 1:185325509-185325531 TTCCCCTCTGTAGCCCAGGCTGG - Intergenic
919274438 1:195394415-195394437 TCCCACTCTGTAGCCCAGGCTGG - Intergenic
919699951 1:200621400-200621422 TCTCGCTCTGCAGCCCAGGCTGG + Intergenic
919920176 1:202162660-202162682 TCCCCCTCCCCAGCCTGGCCTGG + Intergenic
919978042 1:202625641-202625663 GCCCCATCTCCACCCAAGCCAGG + Intronic
920009571 1:202858091-202858113 TCCCCGTCTCAAGCCCAGGCAGG - Intergenic
920092144 1:203462378-203462400 TCCCCCACTCCCCACCAGCCTGG + Intergenic
920238440 1:204525909-204525931 TCTCACTCTCTTGCCCAGCCTGG - Intronic
920312990 1:205059305-205059327 TCCCTCCCTCCAGCCACGCCTGG - Intronic
920396255 1:205648227-205648249 TCTCCCTCTGTCGCCCAGCCTGG - Intergenic
920401087 1:205676779-205676801 CCCCCCTCCCCAGCCCAAGCAGG + Intronic
920501582 1:206488581-206488603 ACCCCCTCACCAGCCCTCCCTGG - Intronic
920866944 1:209760902-209760924 TCTCCCTCTCTTGCCCAGGCTGG - Intronic
920931553 1:210393636-210393658 TCCACCTGTCCACCCCTGCCTGG - Intronic
921003846 1:211072244-211072266 TCTCCCTCTGCCGCCCAGGCTGG - Intronic
921202281 1:212818928-212818950 TCCCACTCTGTAGCCCAGGCTGG + Intergenic
922364235 1:224849072-224849094 TCTCCCTCTGTAGCCCAGGCTGG - Intergenic
922380385 1:225017697-225017719 TTGGCCTCTCCAGCCCAGCTGGG + Intronic
922710361 1:227825228-227825250 TACTGCACTCCAGCCCAGCCTGG - Intronic
922799744 1:228359820-228359842 GCCCACTCTCCAGCTCTGCCCGG + Intronic
923133083 1:231094242-231094264 TCTCCCTCTGCTGCCCAGGCTGG - Intergenic
923471579 1:234295500-234295522 ACTCCCTCTCAAGCTCAGCCTGG - Intronic
923847391 1:237750114-237750136 TCTCACTCTGCTGCCCAGCCTGG - Intronic
924114964 1:240736148-240736170 TCTCACTCTGCAGCCCAGGCTGG - Intergenic
924173755 1:241368091-241368113 TCTCTCTCTGCAGCCCAGGCTGG - Intergenic
1063204116 10:3814406-3814428 CCCTCCCCTCCAGCCCTGCCAGG + Intergenic
1063500596 10:6550301-6550323 TCTCACTCTGCCGCCCAGCCTGG + Intronic
1063612744 10:7576725-7576747 TCCCCCTCTCCATCGCCTCCAGG + Exonic
1063903226 10:10757110-10757132 TCCCCCTCTGTTGCCCAGGCTGG - Intergenic
1064005295 10:11694588-11694610 TCCGCCTCTGCACTCCAGCCTGG - Intergenic
1064058130 10:12115135-12115157 TCGCGCTCTCCACTCCAGCCTGG - Intronic
1064182850 10:13134460-13134482 TCCCACTCTCTTGCCCAGGCTGG + Intronic
1064269647 10:13853349-13853371 TCTCCCTCTGCTGCCCAGGCTGG - Intronic
1064688343 10:17887359-17887381 TCTCGCTCTGCAGCCCAGGCTGG - Intronic
1064977778 10:21136356-21136378 TCTCACTCTCTTGCCCAGCCTGG + Intronic
1065297767 10:24293070-24293092 TCTCCCTCTGTCGCCCAGCCAGG + Intronic
1065357488 10:24856547-24856569 TACTGCACTCCAGCCCAGCCTGG + Intronic
1065383249 10:25110789-25110811 TCCCACTCTGTAGCCCAGGCTGG + Intergenic
1065509678 10:26466165-26466187 TCCCCTTCTACAGCCCCTCCGGG + Intronic
1065551468 10:26872248-26872270 TCTCCCTCTGTAGCCCAGGCTGG + Intergenic
1066058191 10:31700490-31700512 GCCCCCTCGCCTGCCCAGCAAGG - Intergenic
1066117858 10:32256204-32256226 TCCCACTCTGTTGCCCAGCCTGG + Intergenic
1066141397 10:32506820-32506842 TCTCCCTCTCTTGCCAAGCCTGG - Intronic
1066384352 10:34929621-34929643 TGCACCTCTGCAGTCCAGCCTGG - Intergenic
1066541064 10:36447380-36447402 TCTCCCTCTGTAGCCCTGCCTGG + Intergenic
1066553652 10:36586954-36586976 TCCCCCTCTCTTGCCCAGGCTGG - Intergenic
1066571305 10:36775488-36775510 TCTCGCTCTGCAGCCCAGGCAGG - Intergenic
1066576338 10:36829362-36829384 TCTCGCTCTCCTGCCCAGGCTGG + Intergenic
1066653866 10:37681915-37681937 ACCCCCACGGCAGCCCAGCCGGG - Intergenic
1066669779 10:37824709-37824731 TCTCCCTCTGTAGCCCAGGCTGG + Intronic
1067030944 10:42878635-42878657 GCCCCATCCTCAGCCCAGCCAGG + Intergenic
1067222039 10:44351458-44351480 TCTCCCTCTCTCGCCCAGGCTGG + Intergenic
1067432099 10:46251602-46251624 TGTCCCTCACCAGCCCAGCATGG + Intergenic
1067474645 10:46557359-46557381 TGCCCCTCAAGAGCCCAGCCTGG + Intergenic
1067577779 10:47419005-47419027 TGTCCCTCCCCAGCCCAGCATGG - Intergenic
1067691656 10:48505726-48505748 CCCCTCTCTCCATCCCAGCCAGG - Intronic
1068146825 10:53082574-53082596 TCTCCCTCTGTAGCCCAGGCTGG + Intergenic
1068168535 10:53362182-53362204 TCACTCTATCCAGCCCAGGCTGG - Intergenic
1069405617 10:68095029-68095051 TCTCCCTCTGTAGCCCAGGCTGG - Intergenic
1069599066 10:69691826-69691848 TCTCCCTCTGCTGCCCAGGCTGG + Intronic
1069676880 10:70254966-70254988 TGCCCCTCACCATTCCAGCCTGG - Exonic
1069716315 10:70523484-70523506 TCCACCTCACCAGCCCTGGCAGG - Intronic
1069775207 10:70923164-70923186 TCCCACTCTGCTGCCCAGGCTGG + Intergenic
1069894857 10:71673970-71673992 TCCCCGCCACCACCCCAGCCAGG - Intronic
1069899130 10:71696928-71696950 ACCTCCTCCCCACCCCAGCCAGG + Intronic
1069956444 10:72054748-72054770 TCCCACTCTCTTGCCCAGGCTGG + Intergenic
1069965615 10:72112832-72112854 TCCTCCACTGCACCCCAGCCTGG + Intronic
1070182228 10:74025568-74025590 TGCCCCACTGCAGTCCAGCCTGG + Intronic
1070595571 10:77830567-77830589 TCCCCAGCTGCAACCCAGCCTGG + Intronic
1071255825 10:83870712-83870734 TCCCCCAGCCCAGCACAGCCTGG + Intergenic
1071373980 10:84983710-84983732 TGCCCCTCTGCACTCCAGCCTGG + Intergenic
1071566688 10:86674860-86674882 TGCCCCCCTCCAACCCACCCAGG + Intronic
1072068392 10:91892689-91892711 TCTCCCTCTCTCGCCCAGGCTGG + Intergenic
1072214603 10:93277451-93277473 TCTCCTTCTCCACCCCAGCATGG + Intergenic
1072359473 10:94646102-94646124 TCTCCCTCTGTAGCCCAGGCTGG + Intergenic
1072392509 10:95001515-95001537 TCCCGCTCTTTAGCCCAGGCCGG - Intergenic
1072705937 10:97681032-97681054 TCCTTGTCTCCAGCACAGCCTGG + Intronic
1072952745 10:99862077-99862099 CCCCCCTGCCCAGCCCTGCCTGG + Intergenic
1073011858 10:100366444-100366466 TCCCCCTCTGTCACCCAGCCTGG + Intergenic
1073067545 10:100772147-100772169 TCTCACTCTGCAGCCCAGGCTGG + Intronic
1073073913 10:100811584-100811606 TCCCGCACTCCAGCTCTGCCTGG - Intronic
1073136419 10:101222982-101223004 GCCGCCTCTCCTGGCCAGCCCGG + Intergenic
1073251428 10:102122087-102122109 TCCCCATCTCCACCCCCACCAGG + Intergenic
1073329525 10:102661340-102661362 CCGCCCTCCCCATCCCAGCCCGG + Intergenic
1073339882 10:102736463-102736485 TGCACCTCTGCACCCCAGCCTGG - Intronic
1073439459 10:103544072-103544094 TCCCCCTCTGCAGGGCTGCCAGG - Intronic
1073476064 10:103754664-103754686 TCCCCATCACTAGCCCAACCAGG - Intronic
1073726861 10:106242609-106242631 ACATCCTTTCCAGCCCAGCCAGG + Intergenic
1073760484 10:106623693-106623715 TCTCCCTCTGCTGCCCAGGCTGG + Intronic
1074256503 10:111807674-111807696 TCTCACTCTCCTGCCCAGGCTGG - Intergenic
1074626018 10:115187719-115187741 TCTCCCTCTGTAGCCCAGGCTGG + Intronic
1074693328 10:116026456-116026478 TACCCCTCCCCAGCCCAGGCAGG + Intergenic
1074913365 10:117932334-117932356 TCTCCCTCTGTAGCCCAGGCTGG - Intergenic
1075272867 10:121068442-121068464 TCCCGCTCTTTAGCCCAGGCCGG - Intergenic
1075387167 10:122063301-122063323 TCCCAGGCTCCTGCCCAGCCAGG + Intronic
1075541360 10:123317066-123317088 TCCCCCTCTTCAGCACACACGGG + Intergenic
1075599109 10:123754259-123754281 TCTCCCTCTCCGGAGCAGCCTGG + Intronic
1075606467 10:123814993-123815015 TCCCACTCTGTAGCCCAGGCTGG - Intronic
1075793357 10:125101755-125101777 CCTTCCCCTCCAGCCCAGCCAGG + Intronic
1076072305 10:127499949-127499971 TGCGCCTCTCCACCCCTGCCAGG - Intergenic
1076383991 10:130044380-130044402 TCCTCCAGCCCAGCCCAGCCTGG + Intergenic
1076390853 10:130100487-130100509 TCTCCCTCTCTTGCCCAGGCTGG - Intergenic
1076721277 10:132394462-132394484 GGCTCCTCTCCAGCCCAGCCAGG + Intergenic
1076947821 10:133664485-133664507 CCCCGCGCTGCAGCCCAGCCAGG + Intergenic
1076948811 10:133667795-133667817 CCCCGCGCTGCAGCCCAGCCAGG + Exonic
1076949795 10:133671094-133671116 CCCCGCGCTGCAGCCCAGCCAGG + Intronic
1076950779 10:133674393-133674415 CCCCGCGCTGCAGCCCAGCCAGG + Intergenic
1076951769 10:133677703-133677725 CCCCGCGCTGCAGCCCAGCCAGG + Intergenic
1076952758 10:133681013-133681035 CCCCGCGCTGCAGCCCAGCCAGG + Intergenic
1076953742 10:133684312-133684334 CCCCGCGCTGCAGCCCAGCCAGG + Intergenic
1076954726 10:133740664-133740686 CCCCGCGCTGCAGCCCAGCCAGG + Intergenic
1076955715 10:133743974-133743996 CCCCGCGCTGCAGCCCAGCCAGG + Intergenic
1076956705 10:133747284-133747306 CCCCGCGCTGCAGCCCAGCCAGG + Intergenic
1076957692 10:133750593-133750615 CCCCGCGCTGCAGCCCAGCCAGG + Intergenic
1076958677 10:133753892-133753914 CCCCGCGCTGCAGCCCAGCCAGG + Intergenic
1076959666 10:133757202-133757224 CCCCGCGCTGCAGCCCAGCCAGG + Intergenic
1076960650 10:133760501-133760523 CCCCGCGCTGCAGCCCAGCCAGG + Intergenic
1077041862 11:528370-528392 ACCCCCTCGGCAGCCCAGCAGGG + Intergenic
1077118052 11:894270-894292 TCCCTGTCTCCTGCCCTGCCCGG - Intronic
1077181539 11:1219304-1219326 TCCCTATCCCCAGCACAGCCTGG + Intergenic
1077229311 11:1451458-1451480 TGCCCCTCTCCCGGCCAGCCTGG - Intronic
1077403088 11:2368594-2368616 TCCCCCTGCTCAGCTCAGCCCGG + Intergenic
1077433717 11:2528282-2528304 TCCTTCCTTCCAGCCCAGCCTGG - Intronic
1077528500 11:3083605-3083627 TCCCCTTCCCCAGCCCCTCCAGG + Intergenic
1077620272 11:3715616-3715638 TCTCCCTCTCCCGCTCAGGCAGG + Intronic
1077674859 11:4187091-4187113 TCGCCCTCTGGCGCCCAGCCTGG - Intergenic
1077840792 11:5972592-5972614 TCCCCTTCTCCAAGCCAGCTGGG + Intergenic
1078103002 11:8340886-8340908 TCTCACTCTGCAGCCCAGGCTGG + Intergenic
1078163141 11:8859335-8859357 TCTCCCTCTCTCGCCCAGGCTGG + Intronic
1078417474 11:11177716-11177738 TCCCCTTCCCCAGGCCAGACAGG + Intergenic
1078432303 11:11297535-11297557 TCCCCCTGCCCCTCCCAGCCTGG - Intronic
1078740294 11:14059826-14059848 TCCCCCTTTCCACACCTGCCTGG + Intronic
1079368250 11:19828108-19828130 TACCCCACTGCACCCCAGCCTGG + Intronic
1080386035 11:31811742-31811764 GCCCCCACCCCATCCCAGCCGGG + Intronic
1080529899 11:33164441-33164463 TCCCCCTCTGTCGCCCAGGCTGG + Intergenic
1080532332 11:33189209-33189231 TCTCCCTCTGTGGCCCAGCCTGG + Intergenic
1080617696 11:33959409-33959431 TGCCCCTCTGCACTCCAGCCTGG - Intergenic
1080681000 11:34476033-34476055 TCTCACTCTCCTGCCCAGGCTGG + Intergenic
1081463710 11:43297146-43297168 TCTCACTCTACAGCCCAGGCTGG + Intergenic
1081534106 11:43984940-43984962 TCCCCTTCCCCAGCCCTCCCTGG - Intergenic
1081583453 11:44367966-44367988 TTCCCCTCTCCATCCAAGCTTGG - Intergenic
1081658553 11:44873954-44873976 TCTGCCTCTCCAGGCCAGCTGGG + Intronic
1081765409 11:45606762-45606784 TGCCCCTCCCCAGCTCAGGCAGG - Intergenic
1081857138 11:46311110-46311132 TGCCCCCCTCCAGCCCTGTCAGG + Exonic
1081869351 11:46376286-46376308 GCCCCCACTCTATCCCAGCCTGG + Intronic
1081972037 11:47205958-47205980 TCGCTCTGTCCAGCCCAGGCTGG - Intergenic
1082045235 11:47720534-47720556 TCTCCCTCTGTAGCCCAGGCTGG - Intronic
1082101354 11:48175883-48175905 TCTCCCTCTTTTGCCCAGCCTGG + Intergenic
1082810400 11:57476140-57476162 TGCCCCACTCCACCCCACCCAGG + Exonic
1082866766 11:57907163-57907185 TCTCCCTCTGTTGCCCAGCCTGG - Intergenic
1082927795 11:58569430-58569452 TGCGCCACTCCATCCCAGCCTGG - Intronic
1083312284 11:61790242-61790264 TCCCCACCTCCACTCCAGCCAGG + Intronic
1083330197 11:61894052-61894074 TCTCCCTCTGTAGCCCAGGCTGG - Intergenic
1083363690 11:62128699-62128721 GTCCCCTCTCCCACCCAGCCTGG - Intronic
1083576005 11:63792124-63792146 TCCCCCTTTGCCGCCCAGGCTGG + Intergenic
1083670021 11:64294481-64294503 GCACTCACTCCAGCCCAGCCTGG + Intronic
1084005694 11:66322458-66322480 TCACCCCCTGCAGTCCAGCCTGG + Intergenic
1084105870 11:66980085-66980107 TCTCCCTCTGCCGCCCAGGCTGG + Intergenic
1084176886 11:67427427-67427449 TCTCACTCTGCCGCCCAGCCTGG + Intergenic
1084351666 11:68605267-68605289 TCCCCCACTGCACTCCAGCCTGG + Intronic
1084399251 11:68934161-68934183 TTCCCATCACCAGACCAGCCAGG - Intronic
1084491234 11:69479758-69479780 CCACCCTCTCCTGCCCAGCTCGG + Intergenic
1084575287 11:69985087-69985109 TGCCCCTCTCCAGCCCTGTGGGG - Intergenic
1084732972 11:71085410-71085432 TGCCCCACTTCACCCCAGCCTGG + Intronic
1084785374 11:71438853-71438875 TCACCCTCTCCAGCCATGACAGG + Intronic
1084948757 11:72653210-72653232 TTCCCCTCGAGAGCCCAGCCAGG - Intronic
1084965455 11:72742036-72742058 TCACCCTCTCCAGCCAACACAGG - Intronic
1085106358 11:73846694-73846716 TCTCTCTCTCCCACCCAGCCTGG + Intronic
1085273898 11:75286013-75286035 TTCTCCCCTCCAGCCCTGCCTGG - Intronic
1085292102 11:75408433-75408455 CACCACTCTCCAGCCCAACCTGG + Intronic
1085293876 11:75419661-75419683 TCTCCCTCTCTAGCCCAGGTTGG + Intronic
1085390465 11:76179510-76179532 TGTCCCCCTCCAGTCCAGCCAGG + Intergenic
1085550728 11:77368684-77368706 TCCCACTCTGCGGCCCAGGCTGG + Intronic
1085564825 11:77503919-77503941 CCTCTCTCTCCAGCCCAGGCTGG + Intergenic
1085679986 11:78564223-78564245 TCTCACTCTCCTGCCCAGGCTGG + Intronic
1086087090 11:82966443-82966465 TCCCGCTCTTTAGCCCAGGCCGG - Intronic
1086345750 11:85894114-85894136 TCCCCCTCTGCCACCCAGTCTGG + Intronic
1086472428 11:87129582-87129604 TGCCCCACTCCACTCCAGCCTGG - Intronic
1086505689 11:87501590-87501612 TCTCCCTCTGCTGCCCAGGCTGG - Intergenic
1086715426 11:90055986-90056008 TCCCGCTCTTTAGCCCAGGCCGG + Intergenic
1086758786 11:90600824-90600846 TGCACCTCTACACCCCAGCCCGG + Intergenic
1086966282 11:93031580-93031602 TTCCCCACTCCCGCCCACCCTGG - Intergenic
1087047516 11:93855272-93855294 TCCCCCTCTTTTGCCCAGGCTGG + Intergenic
1087075961 11:94127619-94127641 TGTACCTCTCCACCCCAGCCTGG - Intergenic
1087092082 11:94284056-94284078 GCCTCCTCTCCTGCCCAGCCAGG - Intergenic
1087092103 11:94284198-94284220 GCCTCTTCTCCTGCCCAGCCAGG - Intergenic
1087101048 11:94365031-94365053 TCCACCACTGCAGTCCAGCCTGG + Intergenic
1087529242 11:99357972-99357994 TCTCCCTCTCTCGCCCAGGCTGG - Intronic
1087825111 11:102756283-102756305 TCTCCCTCTGCCACCCAGCCTGG + Intergenic
1088813257 11:113405511-113405533 TCCCCGACCTCAGCCCAGCCTGG - Intergenic
1088857659 11:113771014-113771036 TCCACCACTGCAGTCCAGCCTGG - Intronic
1088868918 11:113875321-113875343 ACCCCCTGTCCCGCCCGGCCGGG + Intronic
1089197326 11:116701831-116701853 TCCTCCTCCCTAGCCCAGGCTGG + Intergenic
1089273386 11:117316225-117316247 TCCGCCTCCCCAGCCCGCCCGGG - Exonic
1089318133 11:117605916-117605938 ACCCCATCTCCAACCCATCCAGG - Intronic
1089386947 11:118074715-118074737 TCCCCCTCTGTTGCCCAGGCTGG - Intergenic
1090018165 11:123104163-123104185 TCTCCCTCTGTAGCCCAGGCTGG + Intronic
1090242542 11:125194270-125194292 TCCCCTTCCCCACCCCAGGCCGG + Intronic
1090403389 11:126463118-126463140 TCCCCCAACCCAGCCCTGCCAGG - Intronic
1090743361 11:129687195-129687217 TCTCCCTCTGCTGCCCAGGCCGG - Intergenic
1091216013 11:133902693-133902715 ATCCCTTCTCCAGCCCTGCCAGG + Intergenic
1091343048 11:134834959-134834981 TCTCACTCTCCTGCCCAGGCTGG + Intergenic
1091455072 12:600710-600732 TCTCCCTCTGCTGCCCAGGCTGG + Intronic
1091498348 12:991436-991458 TTGCCCTGCCCAGCCCAGCCCGG - Intronic
1091642883 12:2250882-2250904 TCTCCCTAACCAGCCCAGGCTGG + Intronic
1091759119 12:3076017-3076039 TCTCCCTCTACTGCCCAGGCTGG + Intergenic
1091786287 12:3245101-3245123 CACTCCTCTCCAGCCCAGGCAGG + Intronic
1091794169 12:3287877-3287899 TGCTCCTCTCCCGCACAGCCAGG - Intergenic
1091923792 12:4327377-4327399 TCTCACTCTGCAGCCCAGGCTGG - Intronic
1091953864 12:4619525-4619547 TCTCCCTCTCTTGCCCAGGCTGG - Intronic
1092065115 12:5583621-5583643 TCCCGCTCTTTAGCCCAGGCCGG - Intronic
1092070467 12:5627444-5627466 TTCCCCTCTGCAGCCCACGCCGG + Intronic
1092153746 12:6268781-6268803 TTCACCTCTCCAGGCCAGCCTGG + Intergenic
1092409499 12:8242988-8243010 GCCCCCTCTTCAGTCCAGGCCGG - Intergenic
1092428325 12:8390782-8390804 ACCTCCTCCCCACCCCAGCCAGG + Intergenic
1092429410 12:8396934-8396956 ACCTCCTCGCCACCCCAGCCAGG + Intergenic
1092493668 12:8970084-8970106 TCTCCCTCTGTAGCCCAGACTGG - Intronic
1092572023 12:9736065-9736087 TCTCCCTCTGTCGCCCAGCCTGG + Intergenic
1092679956 12:10968049-10968071 TCTCGCTCTCTAGCCCAGGCTGG - Intronic
1092812497 12:12284974-12284996 TCCCCCTCTGTCGCCCAGGCTGG + Intergenic
1092866657 12:12767624-12767646 TCTCCCTCTGTAGCCCAGGCTGG - Intronic
1093079568 12:14793913-14793935 TCCCACTTTTCAGCCCAGCGAGG - Exonic
1094168483 12:27466366-27466388 TGCACCTCTGCACCCCAGCCTGG + Intergenic
1094696351 12:32822916-32822938 TCCCCTTCTCCAGCTCAACATGG - Intronic
1094818709 12:34209013-34209035 TGCCCTGCTCCAGCCCAGCCAGG - Intergenic
1095426502 12:42080613-42080635 TCCAGCTCTGCAGCCCAGGCTGG + Intergenic
1095725117 12:45443442-45443464 TCCCTCTCTCCTGCCCAGGCTGG - Intergenic
1095892551 12:47248150-47248172 TCTCCCTCTATTGCCCAGCCTGG - Intergenic
1095906945 12:47388452-47388474 TTCCCATCTCCAGCCATGCCTGG + Intergenic
1096069216 12:48765553-48765575 TCCTGCTCTCCAGCCTGGCCTGG + Intergenic
1096189441 12:49605787-49605809 TCTCCCTCTGTAGCCCAGGCTGG + Intronic
1096309105 12:50504925-50504947 ACCGCCTCTCCAGCCCAGTCAGG - Intergenic
1096475691 12:51907549-51907571 TCCCCGGCTCCAGCCCGGTCCGG + Exonic
1096743348 12:53710306-53710328 ACCCCCTTTCCAGCCCCACCTGG - Intronic
1096813374 12:54185785-54185807 TCTCCCTCTGTAGCCCAGGCTGG - Intronic
1097121675 12:56737752-56737774 TCTCCCTCTGCCGCCCAGGCTGG + Intronic
1098328478 12:69327227-69327249 TCTCACACTCTAGCCCAGCCTGG - Intergenic
1098453746 12:70649603-70649625 TCTCACTCTCTCGCCCAGCCTGG + Intronic
1099017241 12:77358780-77358802 TCTCGCTCTGTAGCCCAGCCTGG + Intergenic
1100027922 12:90152165-90152187 TCTCCCTCTCAAGGCCTGCCAGG + Intergenic
1100454867 12:94742174-94742196 TCCCGCTCTTCAGCCCAGGCCGG + Intergenic
1100527517 12:95433389-95433411 TCTCCCTCTTTCGCCCAGCCTGG - Intergenic
1100731788 12:97479167-97479189 TCTCACTCTCTTGCCCAGCCTGG + Intergenic
1100912609 12:99382666-99382688 TCCCACTCTGCAACCCAGGCTGG - Intronic
1101106212 12:101443124-101443146 TCTCCCTCTCTAGCCTAGACTGG - Intergenic
1101866711 12:108525690-108525712 TCCCCATGAGCAGCCCAGCCAGG + Intronic
1101930984 12:109014043-109014065 TCCCACTCTGCTGCCCAGGCTGG + Intronic
1101946784 12:109143417-109143439 TGCCCCACTGCATCCCAGCCTGG + Intronic
1101981129 12:109407666-109407688 TCTCGCTCTGCTGCCCAGCCTGG - Intronic
1102189928 12:110980013-110980035 TCTCCTTCTGCCGCCCAGCCTGG - Intergenic
1102248462 12:111369461-111369483 TCTCCCTCTGCTGCCCAGGCTGG - Intergenic
1102456115 12:113071752-113071774 TCCGCCTCTCCGGCCCAGGCTGG - Intronic
1102572516 12:113835701-113835723 TCTCCCGCCCCAGCCCAACCTGG + Intronic
1102864412 12:116362497-116362519 TCTCCCTCTCTTGCCCAGGCTGG - Intergenic
1102979662 12:117231286-117231308 TCTCACTCTCTAGCCCAGGCTGG - Intronic
1103303840 12:119948708-119948730 TCCGCCACTGCAGTCCAGCCTGG + Intergenic
1103377225 12:120466729-120466751 TCTCCCTCTGCTGGCCAGCCTGG + Intronic
1103544203 12:121688213-121688235 TCTCCCTCTGTTGCCCAGCCTGG + Intergenic
1103597930 12:122035446-122035468 CCAGCCTCTCCTGCCCAGCCCGG + Intronic
1103608415 12:122105748-122105770 TCCCGCTCTTTAGCCCAGGCCGG - Intronic
1103723514 12:122986879-122986901 TCCCTGTCTCCTGCCCAGCCAGG + Intronic
1103776595 12:123370990-123371012 TCTCCCTCTGTAGCCCAGGCTGG - Intergenic
1103796839 12:123509105-123509127 TCTCACTCTCCTGCCCAGGCTGG - Intronic
1103948394 12:124539457-124539479 TCCCCCTCACCCTCCCAGGCAGG + Intronic
1104068941 12:125328255-125328277 CCTCCCTTTCCAGCCCAGCACGG + Intronic
1104297343 12:127528797-127528819 TCTCCATCTCCAGCCCTGGCCGG - Intergenic
1104449642 12:128858639-128858661 TCCCCCTCTGTTGCCCAGGCTGG - Intronic
1104754748 12:131262036-131262058 TCCCTCTCTCCAGGTCTGCCCGG + Intergenic
1104937446 12:132374157-132374179 CCGCCCCCGCCAGCCCAGCCTGG + Intergenic
1105435727 13:20376365-20376387 TCTCCTTCTGCCGCCCAGCCTGG - Intergenic
1105491981 13:20897782-20897804 TCCCGCTCTACAGCCCAGGCTGG + Intronic
1105573330 13:21624816-21624838 TCTCCCTCTGCAGCCTAGGCTGG + Intergenic
1105596656 13:21845489-21845511 TCTCCCTCTGCCGCCCAGGCTGG + Intergenic
1105943810 13:25172627-25172649 TCCCTCTCCCCAGACCAGGCAGG - Intergenic
1106086876 13:26550741-26550763 TCCCCTTCCCCACCCCAGCAAGG + Intergenic
1107085135 13:36419461-36419483 TCCCCCACTGCACTCCAGCCTGG - Intergenic
1107435240 13:40375887-40375909 CCCTCCACACCAGCCCAGCCTGG - Intergenic
1107474229 13:40719972-40719994 TCTCCCTCTGCTGCCCAGGCTGG + Intergenic
1107497071 13:40936922-40936944 TCTCCCTCTGTAGCCCAGGCTGG - Intronic
1107804817 13:44143904-44143926 TCCACCTTTCCAGGTCAGCCTGG + Exonic
1107814364 13:44231283-44231305 TCTCGCTCTGCAGCCCAGGCTGG + Intergenic
1107888631 13:44894851-44894873 TCCACCACTGCAGTCCAGCCTGG - Intergenic
1108340577 13:49495528-49495550 TCCCGCTCTGTAGCCCAGGCTGG + Intergenic
1108381626 13:49860136-49860158 TCTCCCTCTGTAGCCCAGGCTGG - Intergenic
1108818257 13:54316312-54316334 AGCCCCTCTCCACCCCCGCCCGG + Intergenic
1109024391 13:57140836-57140858 TGCGCCTCGCAAGCCCAGCCAGG + Intergenic
1109025378 13:57147406-57147428 TGCGCCTCGCAAGCCCAGCCAGG + Intronic
1109026368 13:57153979-57154001 TGCGCCTCGCAAGCCCAGCCAGG + Intronic
1109027360 13:57160550-57160572 TGCGCCTCGCAAGCCCAGCCAGG + Intergenic
1109028346 13:57167115-57167137 TGCGCCTCGCAAGCCCAGCCAGG + Intergenic
1109116068 13:58387694-58387716 TCCCCCTCTATTGCCCAGGCTGG + Intergenic
1109234220 13:59795482-59795504 TCTCGCTCTCCCGCCCAGGCTGG + Intronic
1109595998 13:64554595-64554617 TCTCCCTCTGCTGCCCAGGCTGG + Intergenic
1109706614 13:66101805-66101827 TCTCCCTCTGTAGCCCAGGCTGG + Intergenic
1109769903 13:66956718-66956740 TCTCACTCTGCTGCCCAGCCTGG - Intronic
1109836454 13:67863520-67863542 TCTCCCTCTCTCGCCCAGGCTGG - Intergenic
1109848699 13:68032501-68032523 TCTCCCTCTGTCGCCCAGCCTGG - Intergenic
1111518941 13:89374295-89374317 TCCCTCTCTGTAGCCCAGGCTGG + Intergenic
1111660063 13:91198492-91198514 TCCCCCTCTCCCTCCCACCCTGG - Intergenic
1111676872 13:91398970-91398992 TCCACGTCTGCAGCTCAGCCAGG + Exonic
1111963330 13:94834968-94834990 TCTCGCTCTGCAGCCCAGGCTGG - Intergenic
1112264682 13:97912599-97912621 TCCCCCTCTATTGCCCAGGCTGG + Intergenic
1112409329 13:99148843-99148865 TCCCACTCTCTGGCCCAGGCTGG + Intergenic
1112516506 13:100058037-100058059 TCTCGCTCTGCAGCCCAGGCTGG + Intergenic
1112641306 13:101278491-101278513 TCTCACTCTCCTGCCCAGGCTGG - Intronic
1113059109 13:106301738-106301760 TCTCACTCTGCAGCCCAGGCTGG - Intergenic
1113234868 13:108261382-108261404 TCTCCCTCTGTAGCCCAGGCTGG + Intronic
1113478099 13:110599695-110599717 TCCCCCTCTGGACTCCAGCCAGG + Intergenic
1113767945 13:112892697-112892719 TCCCCCTTTCCTGCCCATGCTGG + Intergenic
1113769118 13:112897400-112897422 TCCTCCTCCCCAGCCATGCCTGG + Intronic
1113843068 13:113371330-113371352 TCCCACCATCCAGCCCAGCCCGG - Intergenic
1113885576 13:113656929-113656951 TCCCGCTCTGCCGCCCCGCCTGG + Intronic
1113991480 14:16030719-16030741 CCCACCGCTCCAGCCTAGCCAGG - Intergenic
1114289444 14:21275985-21276007 TCTCCCTCTGTAGCCCAGGCTGG + Intergenic
1114502009 14:23176896-23176918 TGCCCCACTCCACTCCAGCCTGG + Intronic
1114567958 14:23646242-23646264 ACCTCCTCTCCACACCAGCCGGG + Intergenic
1115234107 14:31191496-31191518 ACCCCATCTCCAGCCCAGGCTGG - Intronic
1115246104 14:31297254-31297276 TCTCCCTGTGCAGCCCAGGCTGG - Intronic
1115696706 14:35907279-35907301 TCTCCCTCTGTAGCCCAGGCTGG + Intronic
1116076121 14:40112996-40113018 TCTCACTCTGCAGCCCAGGCTGG - Intergenic
1116237041 14:42292140-42292162 TCCCGCTCTTTAGCCCAGGCCGG - Intergenic
1116308689 14:43292640-43292662 TCTCACTCTGTAGCCCAGCCTGG - Intergenic
1117759483 14:59011916-59011938 TCTCCCTCTCTTGCCCAGGCTGG - Intergenic
1118018827 14:61689956-61689978 TCCCACTCTGCTGCCCAGGCTGG + Intergenic
1118229032 14:63930561-63930583 TCCTGCTCTCCTGCCCAGGCTGG + Intronic
1118377218 14:65187848-65187870 TCCTCCTCTCCTCCCCACCCAGG - Intergenic
1118600252 14:67466963-67466985 TCCCCCTCTGTCGCCCAGGCTGG - Intronic
1118843359 14:69528451-69528473 TTCCCCTCCCCCGCCCATCCAGG - Exonic
1119017396 14:71073266-71073288 TCTCCCTCTGTAGCCCAGGCTGG - Intronic
1119068225 14:71552419-71552441 TCCCGCTCTTTAGCCCAGGCCGG + Intronic
1119299679 14:73561638-73561660 TGCACCACTCCACCCCAGCCGGG + Intergenic
1119326130 14:73760454-73760476 TCCCCATCCCCCGCCCAGGCTGG + Intronic
1119401509 14:74365663-74365685 TCCCCCGCTGCAGCTCATCCTGG + Intergenic
1119403366 14:74379247-74379269 TCCCCCTCTGTCGCCCAGGCTGG - Intergenic
1119602764 14:75988179-75988201 TCCCCCTGTGCTGCCCAGGCTGG - Intronic
1119641912 14:76321855-76321877 TCCCGCTCTTTAGCCCAGGCCGG - Intronic
1119645521 14:76345735-76345757 TCCTCCTCTACAGAGCAGCCAGG - Intronic
1119737537 14:76993141-76993163 TCTCCCTCTGTAGCCCAGGCTGG + Intergenic
1119740030 14:77008189-77008211 TCCTCCCCTCCAGAGCAGCCAGG - Intergenic
1119798832 14:77424435-77424457 TCTCCCTCTGCCGCCCAGGCTGG - Intergenic
1120124825 14:80729040-80729062 ACACCCCCACCAGCCCAGCCTGG - Intronic
1120524379 14:85560549-85560571 TCTCGCTCTGCAGCCCAGGCTGG - Intronic
1120601810 14:86520400-86520422 TCTCACTCTGCTGCCCAGCCTGG + Intergenic
1120817085 14:88872413-88872435 TCCGCATCTCCAGCACAGCCAGG - Exonic
1120900536 14:89571477-89571499 TCTCACTCTCCTGCCCAGGCTGG - Intronic
1120914841 14:89701794-89701816 TCCCCCACTCCGGCCCCGCAGGG - Intergenic
1121101756 14:91254274-91254296 TCAGCCTGTCCAGCCCAGCCTGG + Intergenic
1121230784 14:92356316-92356338 TCCACATCTCTAGTCCAGCCAGG + Intronic
1121278747 14:92685454-92685476 TCCCCATCTCCAGCCCCTGCAGG - Intronic
1121280828 14:92696467-92696489 TCTCACTCTGCAGCCCAGGCTGG - Intergenic
1121309735 14:92929321-92929343 CCCCCAACTCCTGCCCAGCCAGG + Intronic
1121309751 14:92929361-92929383 CCCCCAACTCCTGCCCAGCCAGG + Intronic
1121404794 14:93713063-93713085 TCCCCCACCCGAGCCCAGCATGG - Intergenic
1121566736 14:94915667-94915689 TCTCCCTCTGCAGCGCAGGCTGG + Intergenic
1121766402 14:96490391-96490413 TCCCACTCTCTCGCCCAGGCTGG - Intergenic
1121777185 14:96598463-96598485 TCCCTCTCTCCAGCCTCCCCGGG + Intergenic
1121888092 14:97562956-97562978 TCTCCCTCTCCAGCAAACCCAGG - Intergenic
1121920610 14:97877568-97877590 TCCCCCTCTGTTGCCCAGGCTGG + Intergenic
1122140618 14:99660838-99660860 TGCCCCACCCCACCCCAGCCAGG + Intronic
1122161104 14:99784700-99784722 TCCCCCATTCCAGCCCATCCAGG + Intronic
1122682830 14:103479222-103479244 TCTCCCTATGTAGCCCAGCCAGG + Intronic
1122727168 14:103764861-103764883 TCCGCCACTGCAGTCCAGCCTGG - Intronic
1122851996 14:104539215-104539237 TCCCGCTCTTTAGCCCAGGCCGG + Intronic
1122989250 14:105229262-105229284 CGCCCCTTTCCTGCCCAGCCTGG - Intronic
1123034447 14:105466267-105466289 TCCCCACTTCCAGCCCAGTCAGG + Intronic
1202849693 14_GL000225v1_random:9030-9052 CCCCGTGCTCCAGCCCAGCCAGG + Intergenic
1202852583 14_GL000225v1_random:30712-30734 CCCCCTGCTCCAGCCCAGCCAGG + Intergenic
1202860678 14_GL000225v1_random:79394-79416 CCCCGAGCTCCAGCCCAGCCAGG - Intergenic
1202862180 14_GL000225v1_random:89852-89874 CCCCGTGCTCCAGCCCAGCCAGG - Intergenic
1202864261 14_GL000225v1_random:104909-104931 CCCCGTGCTCCAGCCCAGCCAGG - Intergenic
1202921976 14_KI270723v1_random:35312-35334 CCCCGTGCTCCAGCCCAGCCAGG + Intergenic
1202922952 14_KI270724v1_random:2301-2323 CCCCGTGCTCCAGCCCAGCCAGG - Intergenic
1123432921 15:20233672-20233694 TCTCCCTCTCTTGCCCAGGCTGG + Intergenic
1123775275 15:23573438-23573460 TCTCACTCTGCAGCCCAGACCGG - Intronic
1124336708 15:28862649-28862671 TCTCACTCTGCAGCCCAGGCTGG + Intergenic
1124425004 15:29556225-29556247 TCTCTCTCTACAGCCCAGGCTGG - Intronic
1124426978 15:29570745-29570767 TCGCCCGCTCCCGCCCGGCCCGG + Intergenic
1124445201 15:29724255-29724277 CCACTCTCCCCAGCCCAGCCTGG - Intronic
1124485443 15:30110820-30110842 TCTGCCTGCCCAGCCCAGCCTGG - Intergenic
1124493655 15:30173577-30173599 GCCCCATCTCCACCCAAGCCAGG + Intergenic
1124518133 15:30386447-30386469 TCTGCCTGCCCAGCCCAGCCTGG + Intronic
1124540520 15:30579806-30579828 TCTGCCTGCCCAGCCCAGCCTGG - Intergenic
1124651763 15:31479229-31479251 GCCGCCTCTGCAGCCCAGCGAGG + Exonic
1124749912 15:32365072-32365094 GCCCCATCTCCACCCAAGCCAGG - Intergenic
1124758133 15:32427775-32427797 TCTGCCTGCCCAGCCCAGCCTGG + Intergenic
1125141301 15:36410611-36410633 TCCCGCTCTTTAGCCCAGGCCGG - Intergenic
1125582336 15:40795217-40795239 TCTCCCTCTCCCGCCCAGGCTGG - Intronic
1125615023 15:41003372-41003394 TCCACCACTCCACTCCAGCCTGG - Intronic
1125850089 15:42894722-42894744 TCTCACTCTGCTGCCCAGCCTGG - Intronic
1125954587 15:43781191-43781213 CCTCCCTCTCCATCCCACCCAGG - Intronic
1126604923 15:50466563-50466585 TCTCCCTCTGTAGCCCAGGCTGG - Intronic
1126974662 15:54161916-54161938 TCCCTCTCTGTAGCCCAGACTGG - Intronic
1127081025 15:55380323-55380345 TCCCCCTCTGTCGCCCAGGCTGG + Intronic
1127377459 15:58398143-58398165 TCTCCCTCTCCAGCCTCCCCAGG + Intronic
1127546268 15:59996697-59996719 TCCCCCCCTGCAGCGCATCCTGG - Intergenic
1127732371 15:61812602-61812624 TCCCACTCTCCAACCCATCCTGG + Intergenic
1127807152 15:62532091-62532113 TGCCCCTTTGCACCCCAGCCTGG - Intronic
1127908261 15:63393533-63393555 TCCCCCTCTGCTGCCCAGGCTGG - Intergenic
1128021952 15:64399534-64399556 TCTCACTCTCTTGCCCAGCCTGG + Intronic
1128483865 15:68065768-68065790 TCTCCCTCTCTTGCCCAGGCTGG + Intronic
1128589559 15:68882744-68882766 TCTCCCTCTGTAGCCCAGGCTGG - Intronic
1128627223 15:69222181-69222203 TCAGCCCCTCTAGCCCAGCCTGG - Intronic
1128735112 15:70049193-70049215 TCCCTCTCTCCTCCTCAGCCTGG - Exonic
1128794207 15:70452881-70452903 TCCCCCTGTGCTGCCCAGGCTGG + Intergenic
1128797174 15:70474479-70474501 TCCCCATCTCCAGCACACTCTGG + Intergenic
1129082447 15:73052542-73052564 GCCGCTGCTCCAGCCCAGCCCGG - Exonic
1129089817 15:73137468-73137490 TCTCCCTCTGTTGCCCAGCCTGG + Intronic
1129192794 15:73947220-73947242 CCCATCTCTCCAGCCCAACCTGG - Exonic
1129252347 15:74315955-74315977 TCTCCCTCCCCACTCCAGCCAGG + Intronic
1129254648 15:74327153-74327175 TCCCCCTCCCCCACCAAGCCTGG - Intronic
1129292370 15:74578201-74578223 TCTCCCTCTGTAGCCCAGGCTGG + Intronic
1129356596 15:74995989-74996011 TCCCCCCCGCCAGCCCCACCTGG + Intronic
1129445379 15:75613611-75613633 TCTCCCTCTCTTGCCCAGGCTGG - Intronic
1129491917 15:75935815-75935837 TCCCGCTCTTTAGCCCAGGCCGG + Exonic
1129605230 15:77021647-77021669 TCTCGCTCTGCAGCCCAGGCTGG - Intronic
1129717758 15:77862061-77862083 TGCCCCTCCCTACCCCAGCCTGG - Intergenic
1130090180 15:80814389-80814411 CCACCATCTCCAGCTCAGCCTGG + Intronic
1130103474 15:80911882-80911904 TCCCAGCCTCCAGCCCTGCCAGG - Intronic
1130145564 15:81271441-81271463 TCTCCCTCTGCTGCCCAGACTGG - Intronic
1130216741 15:81978991-81979013 TCTCCCTCTGCTGCCCAGGCTGG + Intergenic
1130337267 15:82967205-82967227 TGCCCCACTCCACTCCAGCCTGG + Intronic
1130461006 15:84158184-84158206 TGCCCCTCCCTACCCCAGCCTGG + Intergenic
1131077253 15:89503157-89503179 TCCCTCTCCCCACCCCAGCTTGG + Intergenic
1131171941 15:90184985-90185007 TCCCCCTTGCCAGGCCGGCCCGG - Intronic
1131236529 15:90701691-90701713 TCTCCCTCTGTGGCCCAGCCTGG - Intergenic
1131300468 15:91195199-91195221 TCCACCACTGCACCCCAGCCTGG - Intronic
1131367667 15:91853748-91853770 TCCACCTCTCCAGCCCCGGCAGG + Exonic
1131701005 15:94935277-94935299 TCCTCATCTCCACCTCAGCCTGG + Intergenic
1131880078 15:96852865-96852887 TCCTCTTTCCCAGCCCAGCCTGG - Intergenic
1132031438 15:98441341-98441363 TCTCCCTCTGTAGCCCAGGCTGG + Intronic
1132364384 15:101246250-101246272 TCCCCATCTTCAGCCCAGAGAGG + Intronic
1132489147 16:215979-216001 GCCCCCTTGCCTGCCCAGCCCGG + Intronic
1132490976 16:230778-230800 TCTCCCTCTGTCGCCCAGCCTGG + Intergenic
1132623755 16:880322-880344 TCCCACTCAGCAGCCCAGCCAGG + Intronic
1132829530 16:1920531-1920553 GCCCCCTGCCCAGCCCAGCATGG + Intergenic
1132851178 16:2025682-2025704 CCCTCCTCCCCAGCCCAGCCAGG - Intronic
1132899578 16:2245933-2245955 TCTCCCTCTCTTGCCCAGGCTGG - Intronic
1133029194 16:3001596-3001618 TGCCCCTCGCCTGCCCAGCAAGG + Intergenic
1133098139 16:3461479-3461501 TCCCCATCTCTATCTCAGCCAGG + Intronic
1133104221 16:3496109-3496131 TCTCGCTCTGCAGCCCAGGCTGG - Intergenic
1133111492 16:3550540-3550562 TCCCTCTGCCCAGCCCTGCCTGG - Intronic
1133193518 16:4151968-4151990 TCTCCCTCTGTAGCCCAGGCTGG - Intergenic
1133270972 16:4610647-4610669 TCCCACTCAGCAGTCCAGCCAGG - Intronic
1133301951 16:4787910-4787932 TCCCCACCTACAGCCCAGGCAGG + Intronic
1133350477 16:5097784-5097806 GCCCCCTCTTCAGTCCAGGCCGG - Exonic
1133355844 16:5136168-5136190 TCTCACTCTGCAGCCCAGGCTGG + Intergenic
1133488548 16:6244531-6244553 TCTCCCTCTGTAGCCCAGGCTGG + Intronic
1133782213 16:8948209-8948231 TCCCTCCCACCAGCCCAGGCTGG + Intronic
1133856646 16:9555752-9555774 TCTCACTCTGCTGCCCAGCCTGG - Intergenic
1134058920 16:11187493-11187515 CCCACCTCTGCAGCCCACCCTGG + Intergenic
1134160876 16:11888430-11888452 TCTCCCTCTGTTGCCCAGCCTGG - Intronic
1134536818 16:15033119-15033141 TCCCCTTCTGCAGCCTTGCCAGG + Intronic
1134844656 16:17429765-17429787 TCACCTTCTCCAGCTCAGACCGG + Intronic
1135084535 16:19464378-19464400 TCCCCCACTGCACTCCAGCCTGG + Intronic
1135274641 16:21101773-21101795 TCCTCCTCTCCCTCCCTGCCTGG - Intronic
1135299527 16:21313532-21313554 TCCCAGGTTCCAGCCCAGCCTGG - Intergenic
1135612106 16:23877305-23877327 TCTCCCTCTGCTGCCCAGGCTGG - Intronic
1135747267 16:25027799-25027821 TGCCCCACTCCACTCCAGCCTGG - Intergenic
1136116847 16:28100015-28100037 TCCCACTCTGCCGCCCAGGCTGG + Intronic
1136175487 16:28513502-28513524 TCCCCCTCTGTCGCCCAGGCTGG - Intergenic
1136178031 16:28532009-28532031 TGCACCACTCCACCCCAGCCTGG + Intergenic
1136498804 16:30659549-30659571 TCCCCCTCTGCTGCCCAGCCCGG - Exonic
1136851709 16:33617445-33617467 TCTCCCTCTCTTGCCCAGGCTGG - Intergenic
1136910670 16:34141843-34141865 CCCCCCGCTCCAGCCCAGCCAGG - Intergenic
1136910775 16:34142559-34142581 TCCCCCTCTCCAGCCCAGCCAGG + Intergenic
1137582357 16:49641004-49641026 GCCCCCGCTCCAGGCCAGGCTGG + Intronic
1137674495 16:50297622-50297644 TCCCCTGCACCTGCCCAGCCTGG - Intronic
1137736127 16:50725156-50725178 TCCCACTCTCCATTGCAGCCAGG - Intronic
1138212929 16:55178405-55178427 TCCACATTTCCAGCCCATCCTGG + Intergenic
1138394221 16:56691755-56691777 TCTCCCTCTCTCGCCCAGGCTGG + Intronic
1138815105 16:60194616-60194638 TCTCGCTCTGCAGCCCAGGCTGG - Intergenic
1139015311 16:62683470-62683492 TCACCCTCTGTAGCCCAGGCTGG + Intergenic
1139308979 16:66012345-66012367 TCTCCCTCTGTAGCCCAGGCTGG - Intergenic
1139456082 16:67078514-67078536 TCTCGCTCTCAAGCCCAGGCTGG - Intronic
1139496633 16:67325232-67325254 TCTCGCTCTCTAGCCCAGGCTGG + Intronic
1139546428 16:67651996-67652018 TCCCCCTCACCAGCTGATCCCGG - Exonic
1139822244 16:69729754-69729776 TCCCCCTCTCCTGGCACGCCTGG - Intergenic
1139830587 16:69794497-69794519 TCTCCCTCTGCTGCCCAGGCTGG - Intronic
1139896119 16:70289280-70289302 GCTCCCGCTCCAGCCCAGACTGG + Intronic
1139912459 16:70406479-70406501 CCCCCCACTCCAGCCCAGGCTGG - Intronic
1139962590 16:70726405-70726427 TCCCCCTCCACAGACCACCCTGG + Intronic
1139988795 16:70922175-70922197 TCTCCATCTCCAACACAGCCTGG + Intronic
1140424342 16:74848371-74848393 TGCCCCACTGCACCCCAGCCTGG + Intergenic
1140461278 16:75141689-75141711 TCTCCCTATCCTGCCCAGGCTGG - Intergenic
1140753185 16:78044855-78044877 TCCACCTCTACACTCCAGCCTGG + Intronic
1141110530 16:81267581-81267603 TCTCCCTCTGCTGCCCAGACTGG - Intronic
1141124073 16:81387784-81387806 TCCCCCTCTGTCGCCCAGGCTGG - Exonic
1141132365 16:81444961-81444983 TCCCCGTCGCCCGCCGAGCCCGG + Intergenic
1141174625 16:81710794-81710816 CCGCCCTCTCCAGTCCACCCCGG + Exonic
1141547879 16:84784398-84784420 TCCCACTCTGTAGCCCAGGCTGG + Intergenic
1141617966 16:85220966-85220988 TCCCCCTCCCTGGCCCAGCAAGG + Intergenic
1141623918 16:85251548-85251570 TGCCCTTCTCCAGCCCTGTCTGG - Intergenic
1141651114 16:85393787-85393809 TCCCCCACTGCCCCCCAGCCTGG + Intergenic
1141694094 16:85611846-85611868 TCCCCCTCCCCGCGCCAGCCCGG - Intronic
1141738589 16:85873465-85873487 TCCCACTCTGCCGCCCAGGCTGG + Intergenic
1141890913 16:86925911-86925933 GCCCCATCTGCAGCCAAGCCTGG - Intergenic
1141990383 16:87605891-87605913 TCCCCATCTGCATCCCTGCCTGG - Intronic
1141996765 16:87640982-87641004 TCCTCCTCACAACCCCAGCCTGG + Intronic
1142283138 16:89159919-89159941 TCCGCCTCTCCAGATCTGCCTGG - Intergenic
1142317699 16:89358853-89358875 TCTCCCTCTGCTGCCCAGGCTGG + Intronic
1142348453 16:89569056-89569078 TCTCCCTCTGTTGCCCAGCCTGG - Intergenic
1203113311 16_KI270728v1_random:1465914-1465936 TCTCCCTCTCTTGCCCAGGCTGG - Intergenic
1142503154 17:345248-345270 TCTCACTCTGTAGCCCAGCCTGG - Intronic
1142560919 17:808330-808352 TCTCCCTCTGCTGCCCAGGCTGG + Intronic
1142729822 17:1845901-1845923 TCTTACTCTCCTGCCCAGCCTGG - Intronic
1142743561 17:1943734-1943756 ATCCCCTCTGCAGCCCCGCCTGG + Intronic
1142746690 17:1962830-1962852 TCTCCCTCTGCCGCCCAGGCTGG - Intronic
1142953377 17:3503054-3503076 CCTCCCTCTCCAGCCCCACCAGG + Exonic
1143137903 17:4722112-4722134 TACCTCCCTCCAGCCCAGCCTGG - Intergenic
1143309832 17:5979016-5979038 TCCACCTGTCCACCCCAGCCTGG - Intronic
1143373184 17:6453166-6453188 TCTCCCTCTCTCGCCTAGCCTGG + Exonic
1143431957 17:6894211-6894233 TTCCCCTCCACAGCACAGCCGGG - Intronic
1143457787 17:7078870-7078892 TCCCCAGCTCCACCCCAGACTGG - Exonic
1143476907 17:7208191-7208213 GCCCCCTCTGGAGCACAGCCCGG - Exonic
1143498138 17:7324078-7324100 CCCCCAGCCCCAGCCCAGCCCGG + Intronic
1143524024 17:7462268-7462290 TCCCCCTCACCAGCCCCCACTGG + Exonic
1143600129 17:7939725-7939747 TCTCCCTTTCCAGCTGAGCCTGG - Exonic
1143631050 17:8140612-8140634 TCCCCCACTCCAGAGCAGCTAGG + Exonic
1143653830 17:8281439-8281461 TCTCCCTCTGTAGCCCAGGCTGG + Intergenic
1143695504 17:8612818-8612840 TCTCCCTCTGTAGCCCAGGCTGG - Intronic
1143819472 17:9548132-9548154 TCTCCCTCTGTCGCCCAGCCTGG + Intronic
1144018920 17:11222782-11222804 TCCACGTCTCCACCCCAGCTTGG + Intergenic
1144293608 17:13852484-13852506 TCTCACTCTGCAGCCCAGGCTGG + Intergenic
1144478126 17:15606481-15606503 TGCACCACTGCAGCCCAGCCTGG + Intronic
1144519221 17:15943350-15943372 TCTCCCTCTTTTGCCCAGCCTGG + Intergenic
1144642402 17:16944804-16944826 TCCCTGTCTCCAGCCCTGCCAGG - Intronic
1144702174 17:17347081-17347103 TTCCCTTCCCCAGCCCTGCCAGG + Exonic
1144767926 17:17743016-17743038 TCTCCCTCTGCAGCCCAGGCTGG + Intronic
1144788260 17:17843803-17843825 TCCCCCTCTCCGGGAGAGCCTGG + Intronic
1144789414 17:17849152-17849174 CCGCCCTCTGCAGCCCAGGCTGG - Intronic
1144870206 17:18364794-18364816 TCTCCCTCTCTTGCCCAGGCTGG + Intergenic
1144920170 17:18757225-18757247 TGCACCACTGCAGCCCAGCCTGG - Intronic
1144963593 17:19061337-19061359 TACCCCACTGCACCCCAGCCTGG - Intergenic
1144964097 17:19064703-19064725 TACCCCACTGCACCCCAGCCTGG + Intergenic
1144971566 17:19113189-19113211 TACCCCACTGCACCCCAGCCTGG + Intergenic
1144983869 17:19187441-19187463 TACCCCACTGCACCCCAGCCTGG - Intergenic
1144984356 17:19190798-19190820 TACCCCACTGCACCCCAGCCTGG + Intergenic
1145013909 17:19384758-19384780 TCACCCTCTCCCGGCCAGCTCGG - Intronic
1145219065 17:21073731-21073753 TCCCCCTCTGTCGCCCAGGCTGG + Intergenic
1145272206 17:21410743-21410765 TTCACCCCTACAGCCCAGCCTGG + Intronic
1145310414 17:21698208-21698230 TTCACCCCTACAGCCCAGCCTGG + Intronic
1145983107 17:29025929-29025951 TCTTCCTCCCCTGCCCAGCCTGG + Intronic
1146042213 17:29467301-29467323 TCTCCCTCTGTAGCCCAGGCTGG + Intronic
1146295789 17:31649402-31649424 GCCCACAGTCCAGCCCAGCCTGG + Intergenic
1146721273 17:35125385-35125407 TCTCCCTCTGCTGCCCAGGCTGG - Intronic
1146727620 17:35169042-35169064 TCTCCCTCTGTAGCCCAGGCTGG + Intronic
1146736992 17:35246822-35246844 TCTCCCTCTGCTGCCCAGGCTGG - Intronic
1146769893 17:35559194-35559216 TCCCACTCTGCTGCCCAGGCTGG - Intergenic
1146921653 17:36716823-36716845 TCTCCCTCTCTTGCCCAGGCTGG + Intergenic
1147017429 17:37503394-37503416 TCTCCCTCTGTAGCCCAGGCTGG - Intronic
1147061071 17:37878983-37879005 TCCCGCTCTTTAGCCCAGGCCGG - Intergenic
1147266582 17:39238010-39238032 TCCCCATCTCCAGAGGAGCCCGG - Intergenic
1147330059 17:39693509-39693531 TCTCCCTCTGTCGCCCAGCCTGG + Intronic
1147724501 17:42558199-42558221 TCTCCCTCTCTTGCCCAGGCTGG - Intergenic
1147770468 17:42864505-42864527 GCCCACTCTCCCGCCCAGCAAGG - Intergenic
1147792686 17:43023154-43023176 TCTCCCTCTGTAGCCCAGGCTGG - Intronic
1147947427 17:44087871-44087893 TCTCCCTCTGTCGCCCAGCCTGG + Intronic
1148057466 17:44809229-44809251 TCTCCCTCTCTCGCCCAGGCAGG - Intronic
1148165392 17:45480452-45480474 TCTCCCTCTGCTGCCCAGGCTGG - Intronic
1148331985 17:46818734-46818756 CCCCCCTCCCGAGCCCAGCGCGG + Exonic
1148376673 17:47154057-47154079 TCTCGCTCTCCTGCCCAGGCTGG - Intronic
1148550366 17:48546638-48546660 TCTCTCTCTGCTGCCCAGCCAGG + Intergenic
1148733586 17:49851999-49852021 GACCCAGCTCCAGCCCAGCCTGG - Intergenic
1148741481 17:49895476-49895498 TCTCCCTCTGCTGCCCAGGCTGG + Intergenic
1148742073 17:49898593-49898615 CCCCCAGCCCCAGCCCAGCCTGG + Intergenic
1148852921 17:50563366-50563388 TCTCCATCTCCATCCCTGCCTGG - Intronic
1148907923 17:50922996-50923018 ACCTCCTCCCCGGCCCAGCCAGG + Intergenic
1149160606 17:53687784-53687806 TCTCCCTCTCTCGCCCAGGCTGG + Intergenic
1149700981 17:58655220-58655242 CCCTGCACTCCAGCCCAGCCTGG - Intronic
1149753172 17:59165364-59165386 TCCCCCTCTGTTGCCCAGGCTGG + Intronic
1149786579 17:59440591-59440613 TGCCCCACTGCACCCCAGCCTGG + Intergenic
1149826219 17:59830851-59830873 TCTCCCTCTGTAGCCCAGGCTGG + Intronic
1149840465 17:59959878-59959900 TCTCACTCTCTCGCCCAGCCTGG - Intronic
1149985313 17:61342779-61342801 TCTCCCTCTGTAGCCCAGGCTGG + Intronic
1150044753 17:61901627-61901649 TCCCGCTCTGTAGCCCAGGCTGG + Intronic
1150096974 17:62385410-62385432 TCTCCCTCTGCAGTCCAGGCTGG - Intronic
1150168335 17:62966161-62966183 CGCCCCTCCCCACCCCAGCCCGG + Intergenic
1150389585 17:64782475-64782497 TCCCCACCTGCAGCACAGCCAGG + Intergenic
1150390703 17:64788430-64788452 TCACCCTCTCCACCCCAGATTGG - Intergenic
1150428742 17:65098964-65098986 TCTCGCTCTGCAGCCCAGGCTGG - Intergenic
1150989485 17:70239436-70239458 GCCCTCTCTTCACCCCAGCCAGG - Intergenic
1151263448 17:72935604-72935626 TCTCGCTCTGCAGCCCAGGCTGG + Intronic
1151448280 17:74181488-74181510 TCCCACTCCCCACCCCAGGCTGG + Intergenic
1151545844 17:74792419-74792441 TCCTACTCTGCAGCCCAGACTGG - Intronic
1151619958 17:75239511-75239533 TCCCCACCACCACCCCAGCCAGG - Exonic
1151643966 17:75416859-75416881 TCTCCCTCTACCGCCCAGGCTGG - Intergenic
1151763855 17:76122154-76122176 TCCCGCTCCCCACCGCAGCCCGG - Intergenic
1151797297 17:76354756-76354778 TCTCCCTCTGCCGCCCAGGCTGG + Intronic
1151819014 17:76487276-76487298 TCTCACTCTGCAGCCCAGGCTGG + Intronic
1151846123 17:76656906-76656928 TCCCACTCTCTCGCCCAGGCTGG - Intergenic
1151890630 17:76948840-76948862 TCCGCCTCTGCCGCCCTGCCTGG + Exonic
1151986738 17:77548577-77548599 TCCTCCTCTCCTGGCCGGCCTGG + Intergenic
1152046396 17:77938921-77938943 TCTCCCTCTGTCGCCCAGCCTGG - Intergenic
1152418420 17:80178100-80178122 TCCTCCTCACCTGCCCACCCCGG + Intronic
1152560052 17:81073336-81073358 TCCACCTCCCCACCCCGGCCTGG - Intronic
1152619597 17:81355828-81355850 TCTCTCTCTGCAGCCCAGGCTGG - Intergenic
1152626229 17:81389041-81389063 TCCGCCTCTGCAGCCAGGCCTGG + Intergenic
1152626478 17:81390119-81390141 TCCCCGGCTCCAGCCCAAGCAGG - Intergenic
1152925963 17:83087926-83087948 GCCCCGTCCCCTGCCCAGCCAGG + Intronic
1152944082 17:83189528-83189550 TCCCCCACTCCAGGCTGGCCAGG - Intergenic
1153117584 18:1678274-1678296 TCACCCTCTCTTGCCCAGGCTGG - Intergenic
1153241521 18:3035373-3035395 TCTCCCTCTCTCGCCCAGGCTGG + Intergenic
1153255604 18:3167411-3167433 TCCCGCTCTATAGCCCAGGCTGG + Intronic
1153659168 18:7311190-7311212 TCCTTCTCGCCAGCCCAGCTTGG + Intergenic
1154020689 18:10661913-10661935 TCTCCCTCTCTCTCCCAGCCAGG - Intergenic
1154191692 18:12235702-12235724 TCCCCCTCTCCACGCCAGGAGGG - Intergenic
1154293863 18:13133148-13133170 TCTCCCTCTGCAGCACATCCTGG - Intergenic
1154308453 18:13247988-13248010 TCTCCCTCTCTTGCCCAGGCTGG + Intronic
1154501197 18:14998805-14998827 ACCCGCTCAGCAGCCCAGCCTGG - Intergenic
1155396158 18:25388480-25388502 TCTCGCTCTGCAGCCCAGGCTGG - Intergenic
1156485998 18:37466059-37466081 TCCCCCTTTCTAGGCCAGCTGGG + Intronic
1156495878 18:37524869-37524891 CCCCGCGCCCCAGCCCAGCCCGG - Intronic
1156523329 18:37740864-37740886 TCTCACTCTGTAGCCCAGCCTGG + Intergenic
1157274047 18:46297753-46297775 GCCCCCTCCCCACCCCAGGCTGG + Intergenic
1157297501 18:46456850-46456872 TCCCTCTCTCCTGCTCAGCCAGG - Exonic
1157364228 18:47048862-47048884 TCTCACTCTCTCGCCCAGCCTGG + Intronic
1157473610 18:48008020-48008042 TTCCCCTCTCCAGTCCATCTCGG + Intergenic
1157483200 18:48069095-48069117 TCCCCGGCCCCAGCGCAGCCAGG + Intronic
1157595499 18:48861406-48861428 CCTTCCTCCCCAGCCCAGCCTGG + Exonic
1159330853 18:66992152-66992174 TCTCACTCTGCAGCCCAGGCTGG - Intergenic
1159525223 18:69580361-69580383 TCTCCCTCTCCAAGCCAGCACGG + Intronic
1159781533 18:72666299-72666321 TCTCCCTCTCTTGCCCAGGCTGG + Intergenic
1160154181 18:76420689-76420711 AACCCCTCCCCAGCCCAGCATGG - Intronic
1160207111 18:76843744-76843766 TCTCCCTCTGTAGCCCAGGCTGG - Intronic
1160736769 19:666441-666463 TCTCCCTCTGCCGCCCAGGCTGG + Intergenic
1160830810 19:1104253-1104275 TCCCCCTCCCCACCCCCGGCCGG + Intronic
1160864641 19:1251296-1251318 ACCCCCTCTGCACCCCAACCAGG - Intronic
1160902087 19:1433747-1433769 TCCTATTCTCCAGCCCCGCCGGG + Intronic
1161158216 19:2746029-2746051 TCTCCCTCTGTAGCCCAGGCTGG + Intergenic
1161392736 19:4029628-4029650 TCTCGCTCTGCAGCCCAGGCTGG - Intronic
1161435266 19:4259110-4259132 TCTCCCTCTGCTGCCCAGGCTGG + Intronic
1161440982 19:4291526-4291548 TCCCCACCTCCAGGCCTGCCTGG + Intergenic
1161512213 19:4678140-4678162 TCTCCCTCTGCCGCCCAGGCTGG + Intronic
1161606379 19:5217033-5217055 TCCCCTCCCCCAGACCAGCCTGG + Intronic
1161699120 19:5785357-5785379 TCCCCAACTCCAGCCCACCCAGG + Intronic
1161835026 19:6640052-6640074 TCTCACTCTGCAGCCCAGGCTGG - Intergenic
1161903334 19:7136210-7136232 TCCCACTCTCAACCCCAGCCTGG - Intronic
1161981419 19:7632316-7632338 TCCTGCCCTCCACCCCAGCCAGG - Intronic
1162041353 19:7972839-7972861 TCCCGCTCTGCTGCCCAGGCTGG + Intronic
1162085589 19:8247134-8247156 TCTCACTCTGCCGCCCAGCCTGG - Intronic
1162177262 19:8840152-8840174 TCCCGCTCTATAGCCCAGACTGG - Intronic
1162253374 19:9465962-9465984 TCCCACTCTGTAGCCCAGGCTGG - Intergenic
1162344811 19:10113003-10113025 TCCCTCGCACCAGCCCACCCAGG - Intronic
1162369835 19:10271876-10271898 CCCCCAGCTCCAGCCCAGCTAGG + Intronic
1162403780 19:10461510-10461532 TCCGAATCTGCAGCCCAGCCCGG - Exonic
1162569659 19:11463937-11463959 TCTCCCTCTCTTGCCCAGGCTGG - Intronic
1162613432 19:11775371-11775393 TGCCCCACTGCACCCCAGCCTGG - Intronic
1162690429 19:12425613-12425635 ACTCTCTCTCCAGCCCAGGCTGG + Intronic
1162933075 19:13966785-13966807 TCCCCCTTGCCTGCCCACCCTGG + Intronic
1162984848 19:14263140-14263162 TCTCCCTCTCTTGCCCAGGCTGG - Intergenic
1163029687 19:14536297-14536319 TCCCCCTCTGTTGCCCAGGCTGG + Intronic
1163121671 19:15222190-15222212 TCTCCCTCTCTCGCCCAGGCTGG + Intergenic
1163281440 19:16320474-16320496 TCTCCCTCTGTAGCCCAGGCTGG - Intergenic
1163475432 19:17523297-17523319 TTCCCATCTCCTGCTCAGCCGGG - Exonic
1163481550 19:17559521-17559543 TCCCTGCCTCCAGCCCAGCCAGG + Intronic
1163503418 19:17689130-17689152 TCTCCCTCTGCAGCCCAGGCTGG + Intergenic
1163558069 19:18003667-18003689 TCTCCCTCTGCTGCCCAGGCTGG + Intronic
1163645361 19:18486143-18486165 GCCCCCTCTGCAGGGCAGCCTGG - Intronic
1163686735 19:18716039-18716061 TCCCCACCTGCAGCCCAGCAAGG - Intronic
1163721627 19:18900649-18900671 TCCCCATCTGTAGTCCAGCCTGG + Intronic
1163736920 19:18987451-18987473 TGCACCACTGCAGCCCAGCCTGG - Intergenic
1163753894 19:19095169-19095191 TCTCCCTCTGTAGCCCAGGCTGG - Intronic
1164144999 19:22506768-22506790 TCCCACTCTCTTGCCCAGGCTGG + Intronic
1164176795 19:22782699-22782721 TCTCCCTCTCTTGCCCAGGCTGG + Intronic
1164199343 19:23003779-23003801 TCTCCCTCTGCCGCCCAGGCTGG + Intergenic
1164212590 19:23112691-23112713 TCTCGCTCTGTAGCCCAGCCTGG - Intronic
1164533326 19:29064616-29064638 TCCCCCTCCCAAACCCAGCGTGG + Intergenic
1164616475 19:29669527-29669549 TCACCCTATCAGGCCCAGCCAGG + Intronic
1164756882 19:30696295-30696317 TCCCCCACTCCAGCACTTCCAGG + Intronic
1164988941 19:32670642-32670664 TCCCCCTCTGTTGCCCAGGCTGG - Intronic
1165202463 19:34156291-34156313 TCTCCCTCTCCTGTCCAGGCTGG - Intergenic
1165207405 19:34202207-34202229 TCCTGCTCTGCTGCCCAGCCTGG + Intronic
1165240815 19:34465604-34465626 TCCCCCTCTGTCGCCCAGGCTGG - Intronic
1165244929 19:34493391-34493413 TCCCCTGCTCCAGACCTGCCAGG + Intronic
1165353082 19:35287319-35287341 GAGCCCTCTCCCGCCCAGCCTGG - Intergenic
1165483404 19:36080135-36080157 TCTCCCTCTGCCGCCCAGGCTGG + Intronic
1165734942 19:38170010-38170032 GGCCCCCCTCCAGCCCACCCTGG - Intronic
1165755728 19:38291708-38291730 TGCCCCTCCCCAACCCAGACAGG - Intronic
1165888815 19:39098671-39098693 TCCTCCTCAACAGCTCAGCCTGG - Intronic
1165889094 19:39099961-39099983 TCTCCCTCTGCTGCCCAGGCTGG - Intronic
1165901338 19:39170672-39170694 TCCCGGTGCCCAGCCCAGCCTGG + Intronic
1166081905 19:40449046-40449068 TCTCCCTCTGTAGCCCAGGCTGG - Intronic
1166117462 19:40664449-40664471 TGCCCCACTGCAGTCCAGCCCGG + Intergenic
1166526513 19:43513763-43513785 TGCACCACTCCATCCCAGCCTGG - Intronic
1166560845 19:43731499-43731521 TGCCGCTCTCCACCCCAGCGGGG + Exonic
1166672387 19:44718794-44718816 TCCCTCTCTGGAGCCCTGCCAGG + Intergenic
1166733260 19:45070368-45070390 TGCCCCTCACCAGCCCATGCCGG - Intronic
1166759042 19:45213135-45213157 TCCCCCTCTCCCGGCTGGCCAGG - Exonic
1166791749 19:45402819-45402841 GCCTCCTCTGCACCCCAGCCAGG + Intronic
1166805979 19:45487438-45487460 GCCCCTTCTCCAGCACAGCTGGG - Intronic
1166809261 19:45506205-45506227 TCCCCTTCTCCACCCCACTCTGG - Intergenic
1166835574 19:45665794-45665816 TCTCCCTCTGTAGCCCAGGCTGG - Intergenic
1166945832 19:46395602-46395624 TCCCGCTCTGTAGCCCAGGCTGG - Intergenic
1166957024 19:46471467-46471489 GCCCCCGCTCCGGCCCAGGCGGG + Exonic
1166986181 19:46661073-46661095 CCCCCCGCCCCAGCCCGGCCGGG + Exonic
1167146876 19:47686411-47686433 TCTCCCTCTGCTGCCCAGGCTGG + Intronic
1167174118 19:47853627-47853649 TCTCCCTCTCTTGCCCAGGCTGG - Intergenic
1167247687 19:48383538-48383560 TCCCACTCTGTAGCCCAGGCTGG + Intronic
1167412893 19:49355487-49355509 TCCCCGTCTTCACCCCACCCTGG - Intronic
1167445269 19:49533833-49533855 TCCCCTTCACCACCCCAGCTCGG + Intronic
1167708305 19:51094843-51094865 TCCCCCTCCCCAGCCCCGACTGG - Intergenic
1167800573 19:51738625-51738647 TCTCCCTCTGTAGCCCAGGCTGG + Intergenic
1168026959 19:53649397-53649419 TCCCACTCTGCCGCCCAGGCTGG - Intergenic
1168029751 19:53670100-53670122 TCCCACTCTATTGCCCAGCCTGG + Intergenic
1168059289 19:53882366-53882388 TGCCCCTCTCCTGCCCACCTCGG + Exonic
1168287999 19:55343883-55343905 TACACCCCTCCAGCCCTGCCTGG - Intronic
1168720186 19:58550562-58550584 CCCCCATGGCCAGCCCAGCCTGG + Exonic
925152252 2:1622994-1623016 GCCCCCTCTTCAGCCCTGCCAGG + Intergenic
925159500 2:1674237-1674259 TCTCACTCTGCAGCCCAGGCTGG + Intronic
925342258 2:3145785-3145807 TCCGCTCCTCCAGCCCAGGCTGG - Intergenic
926240068 2:11078719-11078741 TCTCGCTCTGCAGCCCAGGCTGG + Intergenic
926240319 2:11080384-11080406 TCCCCCTGCCCTTCCCAGCCTGG - Intergenic
926356252 2:12043326-12043348 TCTCCCTCTCTTGCCCAGGCTGG - Intergenic
926703262 2:15818377-15818399 TTCTCTTCTCCAGCCCAGGCAGG + Intergenic
926757798 2:16250137-16250159 TGCCCCTGGCCTGCCCAGCCTGG + Intergenic
927148955 2:20184942-20184964 TCCCCCACAGCAGCCCAGCATGG + Intergenic
927229796 2:20811045-20811067 TCCCGCTCTCTCGCCCAGGCTGG + Intronic
927705407 2:25293699-25293721 TCTCCCTCTGTAGCCCAGGCTGG + Intronic
927837588 2:26412805-26412827 TCTCGCTCTCCCGCCCAGGCTGG + Intronic
927865731 2:26586070-26586092 TGCCTCTCTCCAGCTCACCCTGG + Intronic
928082971 2:28326504-28326526 TTCCCAGCCCCAGCCCAGCCAGG + Intronic
928103373 2:28452376-28452398 TCCACCACTTCAGCCCAGCCAGG - Intergenic
928294115 2:30067724-30067746 TCTCACTCTACTGCCCAGCCTGG - Intergenic
928306782 2:30176960-30176982 TCTCCCTCTACTGCCCAGGCTGG + Intergenic
928308847 2:30193508-30193530 TCCTGGTCTCCAGCCCTGCCTGG + Intergenic
929147327 2:38718227-38718249 TCTCCCTCTCTCGCCCAGGCTGG + Intronic
929319240 2:40521313-40521335 TCCCCCTACCCAGCTCAGCAGGG - Intronic
929574739 2:43044318-43044340 CCCCGCTCCCCAGACCAGCCTGG - Intergenic
929668317 2:43850878-43850900 TCCCACTCTGCTGCCCAGGCTGG - Intronic
930052024 2:47223841-47223863 TCCCCCTCTGTCGCCCAGGCTGG - Intergenic
930226678 2:48801170-48801192 TCCCACTCTGTTGCCCAGCCTGG + Intergenic
930354024 2:50294611-50294633 ACCTCCTCTCCACCCCAGGCTGG - Intronic
930565103 2:53008762-53008784 TCCCACTCTGTAGCCCAGGCTGG - Intergenic
930809639 2:55526996-55527018 TCTCACTCTGCAGCCCAGGCTGG - Intronic
930951664 2:57149959-57149981 TCCCGCTCTTTAGCCCAGGCCGG - Intergenic
931032991 2:58204260-58204282 TTCCCCTCTCCAGCTCTCCCCGG - Intronic
931246732 2:60498404-60498426 CCCCTCTGTCCAGCCCAGCCTGG - Intronic
931342411 2:61414216-61414238 TCTCCCTCTGTAGCCCAGGCTGG - Intronic
931429769 2:62198968-62198990 TCTCACTCTCCCGCCCAGGCTGG + Intronic
931472165 2:62549217-62549239 TCCCCTTCTCCAGTCCAGCCTGG + Intergenic
931606923 2:64061835-64061857 TCTCCCACTGCACCCCAGCCTGG + Intergenic
931694223 2:64859882-64859904 ACCCCCGCTCCAGCCCAGCGGGG + Intergenic
931953843 2:67396470-67396492 TCCCCCTCTGTCGCCCAGGCTGG + Intergenic
932341746 2:70966895-70966917 TCTCACTCTGCAGCCCAGGCTGG - Intronic
932369830 2:71177744-71177766 TCCTCCTCCCCAGGGCAGCCAGG - Intergenic
932403208 2:71496295-71496317 TCCCACTCTGCTGCCCAGACTGG - Intronic
932572445 2:72945208-72945230 CCCCCGTGTCCACCCCAGCCAGG + Intronic
932764396 2:74460781-74460803 TGCCCCTCTCCAGCCCTTTCAGG - Exonic
932849919 2:75174464-75174486 TGTCCCACTCCAGCCCACCCAGG - Intronic
932999002 2:76897820-76897842 TCCCCATCTCCATTCCTGCCTGG + Intronic
933037774 2:77421675-77421697 TCTCCCTCTGCCGCCCAGGCTGG - Intronic
933554902 2:83820242-83820264 TCTCCCTCTTCCGCCCAGGCTGG + Intergenic
933732094 2:85464814-85464836 TCTCCCTCTGTAGCCCAGGCTGG + Intergenic
934520545 2:95017668-95017690 TCTCACTCTACAGCCCAGGCTGG + Intergenic
934661666 2:96146397-96146419 CCTCCCTGTCCAGCCCCGCCGGG + Intergenic
934671358 2:96215232-96215254 TCTCCCTCTGTAGCCCAGGCTGG - Intergenic
934679079 2:96269675-96269697 TCTCACTCTGCAGCCCAGGCTGG + Intronic
934748567 2:96776641-96776663 TCTCGCTCTCTCGCCCAGCCTGG + Intronic
934891014 2:98069339-98069361 TCTCCCTCTGTAGCCCAGGCTGG + Intergenic
934903972 2:98182876-98182898 TCTCCCTCTGCCGCCCAGGCTGG - Intronic
935027177 2:99288596-99288618 TCCCACTCTCTCGCCCAGACTGG + Intronic
935112016 2:100103724-100103746 TCCTCCTCCCCACCCCACCCGGG - Intronic
935219110 2:100997117-100997139 TCTCTCTCTCTTGCCCAGCCTGG + Intergenic
935235207 2:101132616-101132638 TCTCACTCTGCAGCCCAGGCTGG + Intronic
935250420 2:101255463-101255485 TCCCGCTCTTTAGCCCAGGCCGG - Intronic
935801375 2:106700124-106700146 TCTACATCTCCATCCCAGCCAGG - Intergenic
936122957 2:109761427-109761449 TCCTCCTCCCCACCCCACCCGGG + Intergenic
936156417 2:110050117-110050139 TCACCTGCTCCAGCCCAGACAGG - Intergenic
936188273 2:110321327-110321349 TCACCTGCTCCAGCCCAGACAGG + Intergenic
936221730 2:110610037-110610059 TCCTCCTCCCCACCCCACCCGGG - Intergenic
936455432 2:112669702-112669724 TCCACCTCTGCACTCCAGCCTGG - Intergenic
936481636 2:112890422-112890444 GCCCCATCTCCAGTCCAACCTGG + Intergenic
936949384 2:117962611-117962633 TCCCACTCTGCCGCCCAGGCTGG - Intronic
937065338 2:119012938-119012960 TGCCCTTCACCAGCCCAGGCGGG - Intergenic
937125675 2:119473789-119473811 TCCCCCTTCTCACCCCAGCCGGG + Intronic
937353094 2:121179703-121179725 TCTCGCTCTCTAGCCCAGGCTGG - Intergenic
937510982 2:122594578-122594600 TCTCTCTCTGCAGCCCAGGCTGG - Intergenic
937558464 2:123189995-123190017 TCTCCCTCTTCCGCCCAGGCTGG - Intergenic
938042758 2:128090010-128090032 TCTCCCTCTCTCGCCCAGGCTGG + Intergenic
938075891 2:128336025-128336047 TGCTCCTCTCCACTCCAGCCTGG + Intergenic
938089740 2:128423623-128423645 TCTCCCTCTGCTGCCCAGGCTGG - Intergenic
938200107 2:129366008-129366030 TCCCCCTCTCTAGCCAAGTCGGG + Intergenic
938545813 2:132330326-132330348 TCTCCCTCTGTAGCCCAGTCTGG + Intergenic
938770473 2:134496925-134496947 GCCCCCTCTGCAGCTCCGCCTGG + Intronic
939208914 2:139145818-139145840 TCCCCCACTGCACTCCAGCCTGG + Intergenic
939990151 2:148870551-148870573 TCTCCCTCTGTAGCCCAGGCCGG + Intergenic
940312836 2:152296415-152296437 TCTCACTCTGCAGCCCAGGCTGG - Intergenic
940998711 2:160178719-160178741 TCTCCCTCTGTAGCCCAGGCTGG + Intronic
941365684 2:164608325-164608347 TCACCCACTGCACCCCAGCCTGG + Intronic
941719648 2:168799736-168799758 TCCCTCTCCCCAATCCAGCCTGG - Intronic
941818542 2:169823027-169823049 TCCGCCACTGCACCCCAGCCTGG - Intronic
941912107 2:170773753-170773775 TCCCACTCTCTTGCCCAGGCTGG + Intergenic
941949860 2:171143474-171143496 TCCCACTCTTCTGCCCAGTCTGG - Intronic
942676038 2:178427824-178427846 TCTCCCTCTTTAGCCCAGGCTGG + Intergenic
943569021 2:189550312-189550334 TCCCACTCTGTAGCCCAGGCTGG - Intergenic
943592985 2:189821425-189821447 TCTCCCTCTGTAGCCCAGGCTGG - Intronic
943731392 2:191306735-191306757 TGAACCTCTCCATCCCAGCCAGG - Intronic
943889281 2:193265871-193265893 TCCCTCTCTGCTGCCCAGGCTGG + Intergenic
944135909 2:196398948-196398970 TCTCCCTCTCTTGCCCAGGCTGG - Intronic
944221674 2:197310279-197310301 GCCCCCTCCCCAGCCCCGCCGGG + Intronic
944425171 2:199573914-199573936 TGCCCCTCTGCACTCCAGCCGGG - Intergenic
944563618 2:200965580-200965602 TCTCCCTCTGCCGCCCAGGCTGG + Intergenic
944580825 2:201131264-201131286 TCTCGCTCTGCAGCCCAGGCTGG + Intronic
944594305 2:201247157-201247179 TCTCACTCTGCCGCCCAGCCTGG - Intronic
944704430 2:202274730-202274752 TCTCGCTCTGTAGCCCAGCCTGG - Intronic
945069097 2:205973220-205973242 TCTCACTCTGCTGCCCAGCCTGG - Intergenic
945152491 2:206805781-206805803 TCTCCCTCTCTTGCCCAGGCTGG - Intergenic
945374819 2:209067717-209067739 TGGCCCTCCCCATCCCAGCCAGG - Intergenic
946013603 2:216586466-216586488 TCACCCTCTGCACTCCAGCCTGG + Intergenic
946170866 2:217894625-217894647 TCCCCCTCTGTCGCCCAGGCTGG - Intronic
946270179 2:218585549-218585571 TCTCCCTCTGCCGCCCAGGCTGG - Intronic
946357384 2:219196641-219196663 TCTCCCTCTGTAGCCCAGGCTGG + Intronic
946358834 2:219206851-219206873 TTCCTCTCCCCCGCCCAGCCCGG - Exonic
946377115 2:219318204-219318226 TCTTACTCTCCAGCCCAGGCTGG + Intergenic
946386137 2:219385660-219385682 TCCCCTTCTCCAGCTCCTCCTGG + Exonic
946723891 2:222642028-222642050 TCTCCCTCTGCTGCCCAGGCTGG + Intronic
946914939 2:224509241-224509263 TCTCCCTCTGTAGCCCAGGCTGG + Intronic
947211557 2:227713370-227713392 TCTCACTGTCCAGCCCAACCTGG - Intronic
947619763 2:231582271-231582293 TCCGCCTCCCCGGCCCAGGCTGG - Intergenic
948426294 2:237888799-237888821 TCTCCCTCTCTTGCCCAGGCTGG + Intronic
948430461 2:237915387-237915409 TCTCACTCTCCTGCTCAGCCTGG - Intergenic
948462579 2:238137476-238137498 GCTTCCTCTACAGCCCAGCCTGG - Intergenic
948478269 2:238235062-238235084 TCCCCCACTGCACTCCAGCCTGG + Intergenic
948596530 2:239082887-239082909 ACCCCCTCGCCCGCCCATCCTGG - Intronic
948619502 2:239225555-239225577 TCCTGCTCTTGAGCCCAGCCAGG - Intronic
948634436 2:239325934-239325956 TCCCACTCTGTTGCCCAGCCTGG - Intronic
948773788 2:240269498-240269520 TTGGCCACTCCAGCCCAGCCAGG - Intergenic
948994695 2:241572498-241572520 TCCTCCTCCCCACCCGAGCCTGG + Exonic
1168831027 20:845322-845344 CCGCCGCCTCCAGCCCAGCCCGG + Exonic
1169046929 20:2540629-2540651 TCCCTCTCTGCCGCCCAGGCTGG - Intronic
1169187809 20:3633365-3633387 TCCCTCTCTCCAGCCAGCCCAGG + Intronic
1169210268 20:3762412-3762434 TCACTCTGTCCAGCCCAGGCTGG + Intronic
1169471684 20:5891459-5891481 TCTGGCTCTCTAGCCCAGCCTGG + Intergenic
1169758688 20:9068633-9068655 TGCCCACCCCCAGCCCAGCCCGG + Intergenic
1169933399 20:10857821-10857843 TCTCCCTCTGTAGCCCAGGCTGG + Intergenic
1170232316 20:14063755-14063777 TCTCACTCTGCAGCCCAGGCTGG + Intronic
1170463011 20:16596798-16596820 TCCCCATGGGCAGCCCAGCCTGG + Intergenic
1170570370 20:17629177-17629199 ACCCCCAGTCCAGCCCAGCCCGG + Intronic
1170598290 20:17821799-17821821 TCCCCCTCTGTCGCCCAGGCTGG - Intergenic
1170630609 20:18061455-18061477 TGCCCCACTACACCCCAGCCTGG + Intergenic
1170644193 20:18182163-18182185 TGCACCACTGCAGCCCAGCCTGG - Intronic
1171179987 20:23085048-23085070 GCCCCCTCTCCAGGACCGCCCGG + Exonic
1171269220 20:23800211-23800233 TCCCTCTCTTTAGCCCAGGCCGG - Intergenic
1171292062 20:23988014-23988036 TCTCCCTCTGTCGCCCAGCCTGG - Intronic
1171767808 20:29299892-29299914 AGCCCCTCTCCAGCCCCGGCTGG - Intergenic
1171770395 20:29318967-29318989 TCCTCCGCTCCAGCCTAGCCAGG + Intergenic
1171780235 20:29410934-29410956 CCCCCTGCTCCAGCCCAGCCAGG - Intergenic
1171813109 20:29761765-29761787 TCCCCCGCTCCAGCCCAGCCAGG + Intergenic
1171814937 20:29777802-29777824 CACCCCTCTCTTGCCCAGCCAGG - Intergenic
1171824199 20:29879198-29879220 CCCCCTGCTCCAGCCCAGCCAGG - Intergenic
1171874671 20:30563059-30563081 TCTCCCTCTGTAGCCCAGTCTGG + Intergenic
1171906125 20:30900551-30900573 CCCCCCGCTCCAGCCCAGCCAGG - Intergenic
1172394785 20:34594145-34594167 TCTCACTCTGCAGCCCAGGCTGG - Intronic
1172614338 20:36273680-36273702 TTCCTCTCTCCAGTCCAGACAGG - Intergenic
1172761939 20:37329121-37329143 TCCCCCTCTGTTGCCCAGGCTGG + Intergenic
1172895091 20:38294774-38294796 TCTCCCTCTGCCGCCCAGGCTGG - Intronic
1172900654 20:38332170-38332192 TCCCCTCCTCTAGCTCAGCCCGG - Intronic
1172921080 20:38482911-38482933 TCCCGCTCTGTAGCCCAGGCTGG + Intronic
1173001435 20:39108667-39108689 ATCCCCTCCCCAGTCCAGCCTGG - Intergenic
1173125620 20:40333392-40333414 TCACCATCTCCAGTCCACCCTGG + Intergenic
1173174593 20:40754786-40754808 TCCCCCTCCCCAGCAGGGCCAGG + Intergenic
1173480816 20:43397930-43397952 TCCCATTCTCCAGGCCAGCCAGG + Intergenic
1173635180 20:44549779-44549801 TGCCCCACTGCACCCCAGCCTGG + Intronic
1173929186 20:46804326-46804348 TTGACCTCTTCAGCCCAGCCAGG + Intergenic
1174051750 20:47771805-47771827 TCCAGGTCTCCTGCCCAGCCAGG - Intronic
1174218132 20:48932809-48932831 TCCTCCACTCCAAGCCAGCCTGG - Intronic
1174270745 20:49366546-49366568 TGCCCCACTCCACCCCATCCTGG + Exonic
1174394429 20:50237852-50237874 TCTCCCTCTGCTGCCCAGGCTGG + Intergenic
1174450363 20:50616370-50616392 CCCCCCTCTCTCGCCCAGGCTGG + Intronic
1174495582 20:50939393-50939415 TCCCACTCTACTGCCCAGGCTGG + Intronic
1174822788 20:53741996-53742018 TCTCCCTCTGTAGCCCAGGCCGG + Intergenic
1174919061 20:54682720-54682742 TACCCCTCCCCACCCCAGCAGGG - Intergenic
1175201594 20:57281617-57281639 ACCCCCACTGCAGTCCAGCCTGG + Intergenic
1175400270 20:58696260-58696282 CTTCCCTCTCCAGCCCAGCATGG + Intronic
1175716020 20:61254164-61254186 CCCCCATCTCCAGCCCAGGCAGG - Intronic
1175746301 20:61459591-61459613 TCCCGCTCTCCATCCCTCCCTGG - Intronic
1175898855 20:62352151-62352173 TTCCCTTCTCCAGCCCCGCTCGG + Intronic
1176254329 20:64143102-64143124 GCCCCCTCTCCAGTCCGCCCAGG + Intergenic
1176389190 21:6154917-6154939 TCCCCCTCCCCAGTCCCGCGGGG + Intergenic
1176938612 21:14897291-14897313 TCTCGCTCTGTAGCCCAGCCTGG + Intergenic
1177326424 21:19595585-19595607 TCTCCCACTGTAGCCCAGCCTGG - Intergenic
1177433806 21:21024855-21024877 TCACCCTCTCTGGCCCAGGCTGG - Intronic
1177677137 21:24315313-24315335 TCTCCCTCTGTAGCCCAGGCTGG - Intergenic
1178064988 21:28894545-28894567 TCCCGCTCTTTAGCCCAGGCTGG - Intergenic
1178503476 21:33144747-33144769 TCTCCCTCTGCGGCCCAGGCTGG - Intergenic
1179277286 21:39903836-39903858 TCCCACTCTTTAGCCCAGGCCGG - Intronic
1179473725 21:41630009-41630031 TCTCCCTCTGCTGCCCAGGCTGG - Intergenic
1179626531 21:42652640-42652662 TCTCCCTCCCCTGGCCAGCCTGG - Intergenic
1179734282 21:43383331-43383353 TCCCCCTCCCCAGTCCCGCGGGG - Intergenic
1180034178 21:45234841-45234863 GCCTCTTCTCCAGCCCAGCCCGG + Intergenic
1180215367 21:46320141-46320163 TCCACCTCTGCACTCCAGCCTGG - Intronic
1180280780 22:10692251-10692273 TCCCCCTCTGTTGCCCAGGCTGG - Intergenic
1180301372 22:11038958-11038980 TCCCACTCTGCCGCCCAGGCTGG - Intergenic
1180315788 22:11276805-11276827 CCCACCGCTCCAGCCTAGCCAGG + Intergenic
1180339550 22:11606670-11606692 CCCCCCGCTCCAGCCCAGCCAGG - Intergenic
1180511582 22:16095947-16095969 TCTCCCTCTGTAGCCCAGGCTGG - Intergenic
1180752705 22:18136175-18136197 TCTCACTCTCTCGCCCAGCCTGG + Intronic
1180847035 22:18989174-18989196 TATGCCTCTACAGCCCAGCCTGG + Intergenic
1180848178 22:18995630-18995652 TCGGCCTCCCCAACCCAGCCAGG + Intergenic
1180877316 22:19180637-19180659 TCCCCATCCAAAGCCCAGCCAGG + Intronic
1180963912 22:19775912-19775934 CAGCCCTCTCCAGCACAGCCTGG - Intronic
1180964244 22:19777787-19777809 TCTCCCTCTGCCCCCCAGCCTGG + Intronic
1181024911 22:20122675-20122697 TCCTCGTCCCGAGCCCAGCCTGG - Intronic
1181028237 22:20137806-20137828 CCACCCTCCCCAGCCCTGCCTGG - Intronic
1181047510 22:20222640-20222662 TCCCCCAGGCCAGCCGAGCCTGG - Intergenic
1181473233 22:23153457-23153479 TCCCACTCACCAGGCCAGCAGGG + Intronic
1181688072 22:24542952-24542974 ACCCCATCCCCACCCCAGCCGGG - Exonic
1181821774 22:25481847-25481869 TCTCGCTCTGCAGCCCAGGCTGG + Intergenic
1181950013 22:26547115-26547137 TCACTCTGTCCAGCCCAGGCTGG + Intronic
1182150073 22:28021526-28021548 TCCCCCCCTGCAGCTCACCCAGG - Intronic
1182380716 22:29884590-29884612 TCTCTCTCTCCCGCCCAGGCCGG + Intronic
1182429817 22:30292899-30292921 TCCCCTTCTGCCTCCCAGCCTGG + Intronic
1182544594 22:31067582-31067604 TCCCCCTCTGTTGCCCAGGCTGG + Intronic
1182644602 22:31797966-31797988 TGCTCCACTCCAGTCCAGCCTGG - Intronic
1182822246 22:33226757-33226779 TCCCGCTCTTTAGCCCAGGCCGG + Intronic
1183060676 22:35334644-35334666 TCCCCCTCCCCCACCCAGCATGG - Intronic
1183168695 22:36167577-36167599 TCTCCCTCTCTAGCCCAGGCTGG - Intergenic
1183374821 22:37457094-37457116 TCCCCACCTCCAGCCCAGCCAGG - Intergenic
1183433086 22:37777675-37777697 TCCCGCTCTGCCGCCCAGGCTGG + Intergenic
1183595682 22:38808704-38808726 TCGCTCTGTCCAGCCCAGGCTGG + Intergenic
1183633819 22:39048953-39048975 TCTCCCTCTGCTGCCCAGGCTGG - Intronic
1183645512 22:39123981-39124003 TGCCCCACCCCAGGCCAGCCGGG + Intronic
1183664647 22:39240263-39240285 TGCCCATCCCCATCCCAGCCAGG + Intronic
1183675549 22:39297127-39297149 TGCCCTTCCCCAGCCCTGCCTGG - Intergenic
1183755490 22:39758466-39758488 TGCCCCACTGCACCCCAGCCTGG - Intronic
1183891739 22:40935345-40935367 TCCCCCTCTGTAGCCCAGGCTGG - Intergenic
1184110043 22:42389166-42389188 CCCTCCTGTCCAGCTCAGCCGGG + Intronic
1184115451 22:42419242-42419264 GTCCCCTCTCCTGCCCAACCAGG + Intronic
1184401580 22:44277603-44277625 TCCAGCTCTCCAGCACTGCCTGG - Intronic
1184464185 22:44659369-44659391 CCCACTCCTCCAGCCCAGCCTGG + Intergenic
1185046674 22:48531871-48531893 CCACCCTCTCCTGCCCTGCCAGG - Intronic
1185211918 22:49575311-49575333 TCCCCCTTTACACCACAGCCTGG - Intronic
1185287884 22:50010602-50010624 TTCGCCTCTCCAGCCCACCCCGG - Intronic
1185292736 22:50035294-50035316 TTCCCCACCCCAGCCCAGGCCGG - Intronic
1185377203 22:50488055-50488077 TGCCCCCCTGCAGCACAGCCAGG - Intronic
1203237881 22_KI270732v1_random:23726-23748 TCCCCCTCTGTTGCCCAGGCTGG - Intergenic
949960393 3:9307297-9307319 TGCCCCACTCCAGCACCGCCAGG + Intronic
950542405 3:13620326-13620348 TCCCCCTCTCCACCCAGGCCTGG - Intronic
950552948 3:13678088-13678110 TCCCGCTCTGTAGCCCAGGCTGG + Intergenic
950730752 3:14954858-14954880 TCTCCCTCTGCCGCCCAGGCCGG + Intronic
951590021 3:24254358-24254380 TCTCCCTCTGTTGCCCAGCCTGG - Intronic
951946131 3:28138449-28138471 TCCCCCTCCCCAAGCCTGCCAGG - Intergenic
952687532 3:36167464-36167486 GCCCCCTCACCAACCCATCCTGG + Intergenic
952900202 3:38107202-38107224 TTCCCCTCCCCATCCCACCCTGG - Intronic
952980184 3:38727847-38727869 ACCCCTTCTCCGCCCCAGCCTGG - Intronic
953056002 3:39387680-39387702 CCCACATCTCCAGCCCAGGCTGG - Intronic
953313155 3:41900285-41900307 TCTGCCTGCCCAGCCCAGCCTGG + Intronic
953680934 3:45037512-45037534 TCTCCCTCTCTCGCCCAGGCTGG + Intergenic
953780967 3:45870123-45870145 GCCCGCTCTCAAGCTCAGCCTGG + Intronic
953911424 3:46895032-46895054 TCTCCCTCTATCGCCCAGCCTGG - Intronic
954042625 3:47900704-47900726 TCTCCCTCTGTAGCCCAGGCTGG - Intronic
954141988 3:48612242-48612264 TCTCCCTCTGTAGCCCAGGCTGG - Intergenic
954204767 3:49050217-49050239 TCCCGCTCTTTAGCCCAGGCCGG - Intronic
954380371 3:50215910-50215932 TCTCTCCCACCAGCCCAGCCTGG - Intronic
954402787 3:50327850-50327872 TACCCCACTACAGCCAAGCCAGG - Intronic
954699414 3:52443535-52443557 TCCACCTCCCTAGCCAAGCCCGG - Intronic
954705903 3:52480350-52480372 CCCCCAACCCCAGCCCAGCCAGG - Intronic
954783051 3:53074415-53074437 TCCACCTGACCAGCCAAGCCTGG - Intronic
955165825 3:56510085-56510107 TCTCCCTCTCTTGCCCAGGCTGG - Intergenic
955912763 3:63874724-63874746 TACCCATCTCCAGTTCAGCCTGG - Intronic
955981419 3:64531495-64531517 TCTCACTTTGCAGCCCAGCCTGG + Intronic
957084861 3:75669575-75669597 CCCCGTGCTCCAGCCCAGCCAGG + Intergenic
957592349 3:82216201-82216223 TCCCGCTCTTTAGCCCAGGCCGG + Intergenic
957919480 3:86730250-86730272 TCTCGCTCTGTAGCCCAGCCTGG - Intergenic
958426561 3:93984964-93984986 TGCCCCACTGCAGCCTAGCCTGG + Intronic
958431225 3:94043685-94043707 TCTCCCTCTCTTGCCGAGCCTGG + Intronic
958901036 3:99886938-99886960 TCTCCCTCTGCTGCCCAGGCTGG - Intronic
959699052 3:109281214-109281236 TCTTGCTCTGCAGCCCAGCCTGG + Intergenic
960036120 3:113104801-113104823 TCTCCATCTGTAGCCCAGCCCGG - Intergenic
960725289 3:120663680-120663702 TTCTCCTCTACATCCCAGCCTGG - Intronic
960805715 3:121581876-121581898 TCTCCCTCACCAGCCCAGGCTGG - Intronic
961176233 3:124837420-124837442 TCTCCAACTCCAACCCAGCCAGG + Intronic
961388213 3:126536382-126536404 TGCCCCCCTCCATCCCAGCCAGG + Intronic
961417874 3:126774552-126774574 TGCCCTTCCCCATCCCAGCCAGG - Intronic
961448558 3:126992263-126992285 TCCTCCACACCAGGCCAGCCTGG - Intronic
961501775 3:127341281-127341303 TCTCCCTCTCCAAGCCAACCAGG + Intergenic
961579764 3:127871157-127871179 TACCCCATTCCAGCCCTGCCAGG + Intergenic
961681791 3:128604352-128604374 TCCCACCCTCCTGCACAGCCAGG - Intergenic
961691746 3:128674907-128674929 ACATCCTCTCCAGCCCAACCTGG + Intronic
962408355 3:135119494-135119516 TGCCCCACTGCACCCCAGCCTGG - Intronic
962729670 3:138268744-138268766 TCTCGCTCTGAAGCCCAGCCTGG - Intronic
962801541 3:138895110-138895132 TCTCCCTCTGTAGCCCAGGCTGG + Intergenic
963010140 3:140760816-140760838 TCCCTCTCCCCAGCTCAGCCTGG - Intergenic
963193596 3:142501772-142501794 TCTCCCTCTGCTGCCCAGGCTGG + Intronic
963872901 3:150437776-150437798 TCCCGCTCTGCCGCCCAGGCTGG - Intronic
963948805 3:151176093-151176115 TCCCACTCCCCTGCCCAGACAGG + Intronic
964795330 3:160490840-160490862 TCTCACTCTCTCGCCCAGCCTGG + Intergenic
965072480 3:163933470-163933492 TCTCCCTCTCTTGCCCAGGCTGG + Intergenic
965585288 3:170312614-170312636 TCTCCCTCTGTTGCCCAGCCCGG - Intergenic
965692023 3:171367497-171367519 TCCCACTCTCTCGCCCAGACTGG + Intronic
965702264 3:171470415-171470437 TCCCGCTCTTTAGCCCAGGCCGG + Intergenic
965797428 3:172455714-172455736 TCCTGCTCTCTAGCCCAGACTGG + Intergenic
966379415 3:179328803-179328825 TCTCACTCTCTAGCCCAGGCTGG + Intronic
966830004 3:183999733-183999755 TGCACCTCTGCACCCCAGCCTGG + Intronic
966853874 3:184180941-184180963 TCACACTCTCCAGCACATCCAGG - Exonic
966866364 3:184260973-184260995 CCCCCCCCTCCAGCCCGGGCTGG + Intronic
966948065 3:184791400-184791422 TCCCCCACTCCAGCACAGCCTGG + Intergenic
967693655 3:192506398-192506420 TCTCCCTTTGCAGCCCAGGCTGG + Intronic
967698491 3:192564091-192564113 TCTCCCTCTGTAGCCCAGGCTGG + Intronic
967743287 3:193026928-193026950 TCTCCCTCTGTAGCCCAGGCTGG + Intergenic
967815605 3:193795888-193795910 TCTCCCTCTTCCGCCCAGGCTGG + Intergenic
967937681 3:194741930-194741952 TCTCCCTCTACCGCCCAGGCTGG - Intergenic
968014929 3:195321250-195321272 TCTCGCTCTGCTGCCCAGCCTGG + Intronic
968297814 3:197591189-197591211 TCTCACTCTGCAGCCCAGGCTGG + Intergenic
968925976 4:3548731-3548753 ACCCCCTCTCCTGCCCAGCAGGG + Intergenic
969219702 4:5751803-5751825 TCTCACTCCCCTGCCCAGCCAGG - Intronic
969246388 4:5935754-5935776 TCTCCCTCTGTCGCCCAGCCTGG - Intronic
969263716 4:6050501-6050523 TCCCCCTTTGCAGCTGAGCCGGG + Intronic
969355558 4:6623300-6623322 TCCGCCTCTGCACTCCAGCCTGG + Exonic
969563725 4:7965459-7965481 TCCCCCTCCCTAGCCGAGCTGGG + Intronic
969647919 4:8443928-8443950 TCCCCGTCTGCTGCCCAGGCTGG - Intronic
969866173 4:10078300-10078322 TTCCCCTCTCCAGCCCAGGAGGG - Intronic
970517480 4:16847659-16847681 TCCGCCACTGCAGTCCAGCCTGG - Intronic
970639189 4:18044971-18044993 TCCCCTTCTCTATCCCAACCAGG + Intergenic
970906872 4:21226214-21226236 TCCCCCTATGCTGCCCAGGCTGG - Intronic
971382841 4:26115412-26115434 TCTCGCTCTGCAGCCCAGGCTGG + Intergenic
971532309 4:27704516-27704538 TCCCGCTCTTTAGCCCAGGCCGG + Intergenic
971783835 4:31074753-31074775 TCTCCCTCTGTAGCCCAGGCTGG - Intronic
972173250 4:36374323-36374345 TCTCCCTCTGTCGCCCAGCCTGG + Intergenic
972418697 4:38867561-38867583 GCCGCCTCTCCAGCCCAGGGCGG - Intergenic
972427367 4:38946210-38946232 TCTCCCTCTGCCGCCCAGACTGG - Intergenic
972522245 4:39870077-39870099 TCTCACTCTGTAGCCCAGCCTGG - Intronic
972640732 4:40923002-40923024 TCCCGCTCTTTAGCCCAGGCCGG + Intronic
973314092 4:48741508-48741530 TCCCTCTCTGCTGCCCAGGCTGG - Intronic
973567262 4:52200965-52200987 TCTCCCTCTCTTGCCCAGGCTGG + Intergenic
973742445 4:53931122-53931144 TCTCCCCCTGCAGCCCAGGCTGG - Intronic
973939584 4:55893143-55893165 TCTCCCTCTGCTGCCCAGGCTGG + Intronic
973963603 4:56137240-56137262 TCTCCCTCTGTTGCCCAGCCTGG - Intergenic
973994092 4:56439264-56439286 TCTCCCTCTCTTGCCCAGGCTGG + Intronic
974641979 4:64642670-64642692 TCTCCCTCTGTAGCCCAGGCTGG - Intergenic
975117471 4:70695573-70695595 TCTCACTCTGCAGCCCAGGCTGG - Intergenic
975203947 4:71623398-71623420 TCTCACTCTGCAGCCCAGGCTGG + Intergenic
975303208 4:72816366-72816388 TCTCCCTCTCCAGCCTTCCCAGG - Intergenic
975754224 4:77556985-77557007 TCTCACTCTGCAGCCCAGGCTGG - Intronic
976015116 4:80542991-80543013 TCAAACCCTCCAGCCCAGCCAGG + Intronic
976196081 4:82532756-82532778 TCTCACTCTGCAGCCCAGGCTGG + Intronic
976270839 4:83229055-83229077 TACCCCACTGCACCCCAGCCTGG - Intergenic
976387280 4:84475443-84475465 TCTCGCTCTGCAGCCCAGGCTGG + Intergenic
976469802 4:85415087-85415109 TCCTCCTCTCCTGCACAGCCTGG + Intergenic
976867658 4:89750102-89750124 TCTCCCTCTGTAGCCCAGGCTGG + Intronic
977075655 4:92445972-92445994 TCTCCCTCTGTAGCCCAGGCTGG + Intronic
977121412 4:93106374-93106396 TCCCCCTCTGTTGCCCAGGCTGG + Intronic
977715841 4:100182638-100182660 TCTCACTCTCTGGCCCAGCCTGG - Intergenic
977958550 4:103058425-103058447 TCTCCCTCTGTAGCCCAGGCTGG + Intronic
979342830 4:119548076-119548098 TCCCGCTCTTTAGCCCAGGCCGG + Intronic
979874942 4:125876558-125876580 TCTCGCTCTGCAGCCCAGCCCGG - Intergenic
979929862 4:126617174-126617196 CTCCCCTCTCAAGACCAGCCTGG + Intergenic
980920404 4:139079874-139079896 TCTCCCTCTGTCGCCCAGCCTGG - Intronic
980938501 4:139249483-139249505 TCCCACTCTCTTGCCCAGGCTGG - Intergenic
981452246 4:144911914-144911936 TCTCCCTCTCTCGCCCAGGCTGG + Intergenic
981578935 4:146233101-146233123 TCCCGCTCTTTAGCCCAGGCCGG + Intergenic
981620956 4:146698264-146698286 TGCGCCACTGCAGCCCAGCCTGG - Intergenic
981779176 4:148406134-148406156 TCTCCCTCTCTTGCCCAGACTGG - Intronic
982009991 4:151097466-151097488 TCACTCTGTCCAGCCCAGGCTGG + Intergenic
982447789 4:155514136-155514158 TGCCCCACTCCACTCCAGCCTGG - Intergenic
982484814 4:155953911-155953933 TCCGCCCCTCGAGCCCAGGCTGG - Exonic
983191207 4:164755448-164755470 TCTCCCTCTGTAGCCCAGGCTGG - Intergenic
983651479 4:170040625-170040647 CCCCGCTCCCCAGCTCAGCCAGG + Intergenic
983814312 4:172103985-172104007 TGCACCACTGCAGCCCAGCCTGG - Intronic
983829988 4:172314635-172314657 TCTCCCTCTGTAGCCCAGGCTGG + Intronic
984000448 4:174235057-174235079 TCTCCCTCTGCTGCCCAGGCTGG - Intergenic
984073050 4:175140508-175140530 TCTCCCTCTGTAGCCCAGGCTGG + Intergenic
984137855 4:175963402-175963424 ACCCACTCTCCACCCCAACCCGG - Intronic
984222695 4:176996993-176997015 TCCCCCTGTGAAGCACAGCCTGG + Intergenic
984555844 4:181213144-181213166 TCTCCCTCTGTTGCCCAGCCTGG + Intergenic
984721261 4:182975165-182975187 TCCACCACTGCACCCCAGCCTGG + Intergenic
984849788 4:184143689-184143711 TGCCCCTCTGCAGCCCAGTGCGG + Intronic
984910850 4:184673157-184673179 TCCCGCTCTTTAGCCCAGGCCGG + Intronic
985058293 4:186055054-186055076 TCTCGCTCTGCAGCCCAGCCTGG + Intergenic
985068134 4:186143574-186143596 TCTCCCTCTGTCGCCCAGCCTGG + Intronic
985131108 4:186739457-186739479 TCGCTCTGTCCAGCCCAGACTGG - Intergenic
985214775 4:187639809-187639831 TCTCCCTCTATAGCCCAGGCTGG + Intergenic
985289294 4:188371315-188371337 TCGCTCTGTCCAGCCCAGGCTGG + Intergenic
985446108 4:190021999-190022021 CCCCGCGCTGCAGCCCAGCCAGG - Intergenic
985451274 4:190065284-190065306 CCCCGCGCTGCAGCCCAGCCAGG + Intergenic
985452265 4:190068579-190068601 CCCCGCGCTGCAGCCCAGCCAGG + Intergenic
985453249 4:190071876-190071898 CCCCGCGCTGCAGCCCAGCCAGG + Exonic
985454239 4:190075169-190075191 CCCCGCGCTGCAGCCCAGCCAGG + Exonic
985455227 4:190078462-190078484 CCCCGCGCTGCAGCCCAGCCAGG + Exonic
985456215 4:190081762-190081784 CCCCGCGCTGCAGCCCAGCCAGG + Exonic
985457199 4:190085056-190085078 CCCCGCGCTGCAGCCCAGCCAGG + Intergenic
985458186 4:190088349-190088371 CCCCGCGCTGCAGCCCAGCCAGG + Exonic
985459175 4:190091649-190091671 CCCCGCGCTGCAGCCCAGCCAGG + Exonic
985463428 4:190174418-190174440 CCCCGCGCTGCAGCCCAGCCAGG + Exonic
985767765 5:1789087-1789109 TCTCCCTCACCAGCCAACCCTGG - Intergenic
985787095 5:1902141-1902163 TTCCCCTCCCCTGCCCAGCATGG - Intergenic
985787112 5:1902210-1902232 TTCCCCTCTTCTGCCCAGCATGG - Intergenic
986489553 5:8275064-8275086 TCTCCCTCTCTTGCCCAGGCTGG - Intergenic
986692830 5:10327992-10328014 TCTCGCTCTCCTGCCCAGGCTGG + Intergenic
986722070 5:10566495-10566517 TCCCCCTGTCCTGGGCAGCCTGG + Intronic
986967650 5:13294669-13294691 TCTCACTCTCTAGCCCAGGCTGG + Intergenic
987316836 5:16731804-16731826 TCCCCATCTCCTGCCTGGCCTGG + Intronic
987386129 5:17331191-17331213 TCTCCCTCTGTAGCCCAGGCTGG - Intergenic
988153186 5:27414529-27414551 TGCCCCACTCCACTCCAGCCTGG - Intergenic
988532401 5:32039133-32039155 TCTCCCTCTCTTGCCGAGCCTGG + Intronic
988689162 5:33555272-33555294 TCTCACTCTGCTGCCCAGCCTGG + Intronic
988849984 5:35171539-35171561 TTCCCCTGTCTAGCACAGCCAGG - Intronic
989580942 5:43033044-43033066 TCCCGCTCTTTAGCCCAGGCGGG + Intergenic
990211217 5:53482772-53482794 ACCCCCTCCCCATCCCCGCCGGG + Intronic
990617102 5:57519165-57519187 TCTCCCTCTCTTGCCGAGCCTGG - Intergenic
990692412 5:58378228-58378250 TCCCGCTCTTTAGCCCAGGCCGG + Intergenic
991064381 5:62410393-62410415 TCTCCCTCTGCCGCCCAGGCTGG + Intronic
991314718 5:65288342-65288364 TCTCCCTCTGTAGCCCAGGCTGG + Intronic
991675483 5:69086350-69086372 TGTCCCACTCCAGCCCAGCTGGG + Intergenic
992040699 5:72827888-72827910 TCTCCCTCTGTTGCCCAGCCTGG - Intronic
992080268 5:73230277-73230299 TCCCCCTGTCCCGCCTACCCAGG - Intergenic
992297283 5:75337570-75337592 CCCGCCTCTCAAGCCCACCCCGG - Intronic
992379054 5:76219097-76219119 TTCCTCTCAGCAGCCCAGCCAGG + Intronic
992534515 5:77685277-77685299 TCTCCCTCTGTAGCCCAGGCTGG - Intergenic
992648719 5:78836424-78836446 TCCCTCTCTGGAGCCCACCCAGG - Intronic
992649751 5:78847320-78847342 TCTCCCTCTGCTGCCCAGGCTGG + Intronic
992685036 5:79191281-79191303 TCTCCCTCTGTTGCCCAGCCTGG - Intronic
992776450 5:80093326-80093348 TCCCCCTCTGCTGCCCAGGCTGG - Intergenic
992794267 5:80241655-80241677 TGCACCTCTGCACCCCAGCCTGG + Intronic
993002635 5:82397011-82397033 TCCCCATCTCCAGAGCAGCCAGG - Intergenic
993079564 5:83278955-83278977 TCCACCACTCCACTCCAGCCTGG + Intronic
993472567 5:88323648-88323670 TCCCGCTCTTTAGCCCAGGCCGG - Intergenic
993909513 5:93664112-93664134 CCCCCCACCCCCGCCCAGCCTGG - Intronic
993925486 5:93860261-93860283 TCTCCCTCTGCTGCCCAGGCTGG - Intronic
994146455 5:96401055-96401077 TCCCGCTCTTTAGCCCAGGCCGG - Intronic
994425122 5:99575874-99575896 TCCTCATCTCCACCTCAGCCTGG - Intergenic
994436216 5:99736371-99736393 TCCTCATCTCCACCTCAGCCTGG + Intergenic
994553952 5:101272809-101272831 TCTTCCACTCCACCCCAGCCTGG + Intergenic
995502945 5:112828480-112828502 TCTCCCTCTCTTGCCCAGGCTGG + Intronic
995888857 5:116927029-116927051 TGCCCTTCCCCATCCCAGCCTGG + Intergenic
996375772 5:122805259-122805281 TCTCGCTCTTCTGCCCAGCCTGG - Intronic
996573656 5:124959947-124959969 TCTCCCTCTGTTGCCCAGCCTGG + Intergenic
996695588 5:126391288-126391310 TCTCCCTCTCTTGCCCAGGCTGG - Intronic
996988619 5:129600897-129600919 TCTCCCTCTGTAGCCCAGGCTGG + Intronic
997163410 5:131633303-131633325 TCTCCCTCTATAGCCCAGGCTGG - Intronic
997519151 5:134511523-134511545 TCTGCCTCTCCTGCCCAACCCGG + Intergenic
997914211 5:137908262-137908284 TCCCCCACTGCACTCCAGCCTGG + Intronic
997923184 5:138002488-138002510 TACTGCACTCCAGCCCAGCCTGG + Intronic
997937948 5:138130880-138130902 TGCACCTCTCCACTCCAGCCTGG + Intronic
997938800 5:138137973-138137995 TCTCCCTCTGTAGCCCAGACTGG - Intronic
997985954 5:138501845-138501867 TCCCCCTCTGCAGGCCCTCCAGG + Intergenic
997989793 5:138534993-138535015 TCTCCCTCTATAGCCCAGGCTGG + Intronic
998002849 5:138638513-138638535 TCTCGCTCTGCTGCCCAGCCTGG - Intronic
998118068 5:139553821-139553843 CGCGCCTCTGCAGCCCAGCCTGG - Intronic
998166792 5:139848729-139848751 TCCCCCGCGCCGGCCCGGCCTGG - Intronic
998200343 5:140113833-140113855 TCCCTCTCCCCCACCCAGCCAGG + Intronic
998207174 5:140166156-140166178 GCCCCCTCCCCTCCCCAGCCTGG - Intergenic
998336658 5:141377887-141377909 TCCCCCTCTGTTGCCCAGTCTGG + Intronic
998488880 5:142528536-142528558 TGCCCCTCTGCACTCCAGCCTGG + Intergenic
998491678 5:142552048-142552070 TCCTGCTCTCCAGCCCAGGAGGG - Intergenic
998499383 5:142618962-142618984 TCCCGCTCTTTAGCCCAGGCCGG + Intronic
998523938 5:142825473-142825495 TCCCGTTGTCCAGCCCAGCAGGG + Intronic
999151423 5:149428824-149428846 TCCACCTCTCCAGCTCTGGCCGG - Intergenic
999253131 5:150194397-150194419 TCTCCCTCTGTTGCCCAGCCTGG - Intronic
999473790 5:151879382-151879404 TCCCACTCTCTTGCCCAGGCTGG + Intronic
999534662 5:152503563-152503585 ACACCCTATCCAGCCCGGCCTGG - Intergenic
999771577 5:154780051-154780073 TCCCCCAATCCAGGCCAGCCTGG - Intronic
1000170961 5:158702712-158702734 TCTCCCTCTGTAGCCCAGGCTGG - Intronic
1000267165 5:159648472-159648494 TCCCGCTCTTTAGCCCAGGCCGG - Intergenic
1000416286 5:160987386-160987408 TCCCACTCTGCTGCCCAGGCCGG + Intergenic
1001226155 5:169946267-169946289 CCCCCACATCCAGCCCAGCCAGG + Intronic
1001314381 5:170632118-170632140 TCCCCAACTCCAGCTGAGCCTGG - Intronic
1001406761 5:171482211-171482233 TCCCTATCCCCAGCTCAGCCTGG + Intergenic
1001591382 5:172867605-172867627 CCCTCCTGCCCAGCCCAGCCAGG - Intronic
1001612353 5:173013136-173013158 TGCGCCACTCCAGTCCAGCCTGG + Intronic
1001821246 5:174712150-174712172 TCTCCCTCTCTTGCCCAGGCTGG + Intergenic
1001922451 5:175611219-175611241 CCCCACTCCCCAGCACAGCCTGG + Intergenic
1001937921 5:175719214-175719236 TCTCGCTCTCTAGCCCAGGCTGG + Intergenic
1002143263 5:177158366-177158388 TCTCCCTCTGTAGCCCAGGCTGG + Intronic
1002300215 5:178253510-178253532 TCTCCCTCTGTTGCCCAGCCTGG + Intronic
1002331288 5:178442768-178442790 TCCCCCTCGCCACCCCTGCTGGG + Intronic
1002533692 5:179864560-179864582 TCCCCCTCCCCAGCTGACCCAGG - Intronic
1002574064 5:180161621-180161643 TCCCCCTCTCGGGCTCGGCCTGG - Intronic
1002600099 5:180349261-180349283 TGCCCCACTGCATCCCAGCCTGG + Intronic
1002652278 5:180707636-180707658 TCTCCCTCTTCCGCCCAGGCTGG - Intergenic
1002700082 5:181117741-181117763 TCCCCATCTGCAGCCAACCCTGG - Intergenic
1003139352 6:3457328-3457350 TCCTCCTCCCCCGCCCCGCCCGG - Intergenic
1003146341 6:3513444-3513466 TGCCCCTGTCCTGCCCTGCCGGG + Intergenic
1003368928 6:5506081-5506103 CCCTCCCCTCCAGCCCAACCTGG + Intronic
1003621570 6:7705443-7705465 TCTCCCTCTGTTGCCCAGCCTGG + Intergenic
1003894725 6:10596489-10596511 TCTCACTCTCTTGCCCAGCCTGG - Intronic
1003993540 6:11513501-11513523 TCTCACTCTGCAGCCCAGGCTGG - Intergenic
1004141596 6:13022985-13023007 TCTCCCTCTATGGCCCAGCCTGG - Intronic
1004331090 6:14721975-14721997 TGCCCCACTGCACCCCAGCCTGG + Intergenic
1004372865 6:15067526-15067548 TCTCACTCTCCTGCCCAGGCTGG + Intergenic
1004381939 6:15140039-15140061 TCTCCCTATCCTGCCCAGGCTGG + Intergenic
1004439228 6:15631731-15631753 TCCCCCTCCCCAGCCCCTGCAGG + Intronic
1004665651 6:17746155-17746177 TCCCACTCTCTTGCCCAGGCTGG - Intergenic
1004669436 6:17781964-17781986 TCCCGCTCTGTAGCCCAGGCTGG + Intronic
1004738230 6:18429850-18429872 TTCTCCTCTCCAGCCCAGCCTGG - Intronic
1004742970 6:18480940-18480962 TCTCCCTCTCTTGCCCAGGCTGG + Intergenic
1005044510 6:21629122-21629144 TGCGCCTCTGCAGTCCAGCCTGG - Intergenic
1005191233 6:23227241-23227263 TCTCCCTCTGTAGCCCAGTCTGG + Intergenic
1005213404 6:23496240-23496262 TTCCTCTCTCCAGCCTAGCATGG - Intergenic
1005579034 6:27216165-27216187 TCTCGCTCTACAGCCCAGGCTGG - Intergenic
1005801137 6:29426616-29426638 TACTCCTCTCCAACCCATCCTGG + Exonic
1005807939 6:29492432-29492454 TCTCCCTCCCCTGCCCAGGCTGG - Intergenic
1005947345 6:30604039-30604061 TTCCCTTCTCCCGCTCAGCCTGG + Exonic
1006389840 6:33751836-33751858 TCCACTTCCCCAGCCAAGCCCGG + Intergenic
1006549091 6:34805561-34805583 TCGCCTTCTGCTGCCCAGCCTGG - Intronic
1006671439 6:35731945-35731967 TCCCCCACTCCCGCCGCGCCCGG - Intergenic
1006762016 6:36471119-36471141 TCTCCCTCTCTTGCCCAGGCTGG - Intronic
1006866845 6:37215539-37215561 TCTCGCTCTGCAGCCCAGGCTGG - Intronic
1007421198 6:41720768-41720790 TACCCCACCCCACCCCAGCCAGG + Intronic
1007428792 6:41764397-41764419 TGCCCCTCTTCAGCCTGGCCTGG - Intergenic
1007573801 6:42911756-42911778 TCCCACCCTCCAGCCCAGGGAGG - Intergenic
1007631456 6:43275480-43275502 TCCCCATCCGCACCCCAGCCTGG - Intronic
1007695828 6:43733878-43733900 TTTCCCACTCCAGCCCAGCAGGG - Intergenic
1007782684 6:44263484-44263506 GCCCCCTCCCCAGCCCAGACGGG - Intronic
1007897240 6:45375573-45375595 TCTCCCTCTGCAGCCCAGGCTGG + Intronic
1008054369 6:46931022-46931044 TCTCCCTCTGTTGCCCAGCCTGG - Intronic
1008113558 6:47520450-47520472 TCTGCCTCTCCAGCCAAGGCAGG - Intronic
1008591791 6:53000818-53000840 CACCCCCCTCCACCCCAGCCTGG - Intergenic
1009433940 6:63596693-63596715 TCTCCCTCTATCGCCCAGCCTGG - Intergenic
1009625485 6:66135204-66135226 TCCCCTTCTCCACCTCTGCCAGG - Intergenic
1009877963 6:69530089-69530111 TCCCTCTCTCTGCCCCAGCCAGG + Intergenic
1010239943 6:73606070-73606092 TCTCACTCTGCAGCCCAGGCTGG + Intronic
1010252371 6:73721392-73721414 TCTCCCTCTGTAGCCCAGGCTGG + Intronic
1010256131 6:73760375-73760397 TCCCGCTCTTTAGCCCAGGCCGG - Intronic
1011447274 6:87454950-87454972 TCTCCCTCTGTCGCCCAGCCTGG + Intronic
1011561147 6:88617238-88617260 TCTCCCTCTCTTGCCCAGGCTGG - Intronic
1011633082 6:89346084-89346106 TCCCCCTGTCTTGCCCAGGCTGG + Intronic
1011677250 6:89746562-89746584 TCTCCCTCTGTAGCCCAGGCTGG - Intronic
1012100049 6:95072476-95072498 TCTCGCTCTGCAGCCCAGTCTGG + Intergenic
1012187848 6:96243614-96243636 TCCCTCTCTTTAGCCCAGGCCGG + Intergenic
1012689931 6:102297513-102297535 TCTCCCTCTCAAGCTCAACCTGG + Intergenic
1013263714 6:108472831-108472853 TCTCCCTCTGTAGCCCAGGCTGG + Intronic
1013601577 6:111710116-111710138 CCACCCTCTCCCGCCCAGCCTGG + Intronic
1014523486 6:122473079-122473101 TCTCGCTCTGCAGCCCAGGCTGG - Intronic
1015355735 6:132275349-132275371 ACCCCCTCTCCCACACAGCCTGG + Intergenic
1015604868 6:134944095-134944117 TCTCACTCTGTAGCCCAGCCTGG + Intronic
1016334349 6:142988574-142988596 TCCCCCTCTGTTGCCCAGGCTGG + Intergenic
1016400094 6:143670951-143670973 TCTCGCTCTGCAGCCCAGGCTGG + Intronic
1016651465 6:146466191-146466213 TCTCCCTCTGTAGCCCAGGCTGG + Intergenic
1017034195 6:150252318-150252340 TCCCCATCTGCAGTGCAGCCAGG + Intergenic
1017072538 6:150588466-150588488 TCCACCACTACACCCCAGCCTGG + Intergenic
1017366205 6:153643160-153643182 TCTCACTCTGCAGCCCAGGCTGG + Intergenic
1017651825 6:156590564-156590586 TCCTCCTCACCAGCCCAGTAGGG - Intergenic
1017653271 6:156602126-156602148 TACACTTCTCCAGCCAAGCCCGG + Intergenic
1017856131 6:158350693-158350715 TCTCCCTCTCTTGCCAAGCCTGG - Intronic
1017886233 6:158601713-158601735 CCCGCCACTGCAGCCCAGCCTGG + Intronic
1017934749 6:158995636-158995658 TGCACCTCTGCAGTCCAGCCTGG - Intronic
1018197011 6:161364137-161364159 TCTCCCTCTGCTGCCCAGGCTGG - Intronic
1018283935 6:162217408-162217430 TCTCCCTCTGTTGCCCAGCCTGG + Intronic
1018710703 6:166496569-166496591 TACTCCTCTCCACTCCAGCCTGG + Intronic
1019104853 6:169659909-169659931 TGCCCCTCCCCAGCTCAGCCAGG - Intronic
1019243920 6:170694068-170694090 TCTCACTCTGCTGCCCAGCCTGG + Intergenic
1019338067 7:494493-494515 TCCCCTCCTCCTGCCCATCCCGG + Intergenic
1019360428 7:601880-601902 TACCCCTCCCCAGCCCCCCCGGG - Intronic
1019555317 7:1626436-1626458 TCTCGCTCTCCTGCCCAGGCTGG - Intergenic
1019714130 7:2530561-2530583 CCCCCCAGTCTAGCCCAGCCAGG + Intergenic
1019729470 7:2622391-2622413 TCCCCCTCCCCTGCCTGGCCAGG - Intergenic
1020077542 7:5268313-5268335 TCTAGCTCTGCAGCCCAGCCTGG + Intergenic
1020140745 7:5610360-5610382 TCCACCACTGCAGTCCAGCCTGG + Intergenic
1020186462 7:5962802-5962824 ACCCCCACTCCAGCCCAGTCAGG - Intronic
1020249731 7:6458005-6458027 TCTCCCTCTGTAGCCCAGGCTGG + Intronic
1020251739 7:6474692-6474714 TCTCCCTCTGCTGCCCAGGCTGG + Intronic
1020296452 7:6761972-6761994 ACCCCCACTCCAGCCCAGTCAGG + Intronic
1021038150 7:15826671-15826693 TCTCGCTCTGCCGCCCAGCCTGG - Intergenic
1021713073 7:23435785-23435807 TCTCGCTCTGCAGCCCAGGCTGG + Intronic
1022209460 7:28194641-28194663 TGCCCCTCTCCACTCCAGACGGG - Intergenic
1022480250 7:30738873-30738895 CCCCTCTCCCCAGCCCAGCAAGG - Intronic
1022872545 7:34494276-34494298 TCCCACTCTGCTGCCCAGGCTGG - Intergenic
1023690117 7:42777868-42777890 TCTCACTCTCCTGCCCAGGCTGG + Intergenic
1023914968 7:44581966-44581988 CCCTCCTCCCGAGCCCAGCCGGG - Intronic
1024638359 7:51309272-51309294 TCCCCCTCCTCAGGCCAGGCTGG + Intronic
1024726306 7:52200162-52200184 TCTCGCTCTGCAGCCCAGGCTGG - Intergenic
1024983525 7:55177237-55177259 TCCCCCTCTCCATCCCAGTGTGG - Intronic
1025020213 7:55474693-55474715 CCGCCCTCTCCAGTCCAGCAGGG - Intronic
1025227278 7:57176800-57176822 TCTCCCTCTGCTGCCCAGACCGG + Intergenic
1025739556 7:64183983-64184005 GCCCCCTACTCAGCCCAGCCTGG + Intronic
1025985236 7:66445005-66445027 TCACACTCTGCAGCCCAGGCGGG + Intergenic
1026107196 7:67430641-67430663 TCTCACTCTGCAGCCCAGGCTGG + Intergenic
1026222564 7:68413302-68413324 TCTCCCTCTGTAGCCCAGGCTGG + Intergenic
1026339384 7:69422215-69422237 TCAACCCCCCCAGCCCAGCCTGG - Intergenic
1026444461 7:70471924-70471946 TCCCCCTCTCCACTCTGGCCCGG - Intronic
1026551868 7:71375613-71375635 TCTCCCTCTGCTGCCCAGGCTGG + Intronic
1026820300 7:73543204-73543226 TCTCACTCTGCAGCCCAGGCTGG + Intronic
1026928640 7:74210602-74210624 TCCCTCTCTCCCTCCCAGCTAGG + Intronic
1026977854 7:74509325-74509347 TCCCCCTCTGTTGCCCAGGCGGG - Intronic
1027198617 7:76048305-76048327 TGACCCTCTCCAGGCCAGCCTGG + Intronic
1027208448 7:76123616-76123638 TCACACTCTGCAGCCCAGGCGGG + Intergenic
1027253476 7:76414466-76414488 TCCCACTCTCCAGTCATGCCAGG - Intronic
1027291894 7:76722942-76722964 TCTCACTCTATAGCCCAGCCTGG - Intergenic
1027987315 7:85309744-85309766 TCCCCCTCTGTCGCCCAGGCTGG + Intergenic
1028194545 7:87890487-87890509 ACCCCCACTGCAGTCCAGCCTGG + Intronic
1028370332 7:90085273-90085295 TTCCCCACTGCACCCCAGCCTGG - Intergenic
1028535480 7:91886913-91886935 TCTCCCTCTCTTGCCGAGCCTGG + Intergenic
1028970818 7:96857188-96857210 TCTCCCTCTGTAGCCCAGGCTGG + Intergenic
1029062895 7:97816739-97816761 TCCCGCTCTTTAGCCCAGGCCGG - Intergenic
1029157872 7:98530048-98530070 TCTCCTTCTCTAGCCCAGGCTGG - Intergenic
1029361914 7:100094066-100094088 CCTCCCGCTCCAGCCCTGCCGGG - Intronic
1029575210 7:101398944-101398966 TCCCCCTGTGCAGCCCACCCAGG - Intronic
1029597695 7:101546447-101546469 ACCACATCTCCAGACCAGCCTGG - Intronic
1029687388 7:102158109-102158131 TCCTCCTCTCACCCCCAGCCTGG + Intronic
1029694371 7:102203339-102203361 ACCCCCTCCCCTGCCAAGCCAGG + Intronic
1029706026 7:102276329-102276351 TCCCGCTCTCTTGCCCAGGCTGG + Intronic
1029900693 7:104036279-104036301 TACACCACTCCACCCCAGCCTGG - Intergenic
1030431861 7:109457985-109458007 TCCCGCTCTTTAGCCCAGGCCGG - Intergenic
1031220663 7:118960281-118960303 TCTCCCTCTGTAGCCCAGGCTGG - Intergenic
1031685330 7:124726866-124726888 TCCCTCTCTGTAGCCCAGGCTGG - Intergenic
1031991255 7:128200779-128200801 TCTCCCTATGCTGCCCAGCCTGG - Intergenic
1032012221 7:128354093-128354115 TCCACCTATCCATCCCTGCCAGG - Intronic
1032328469 7:130954692-130954714 TGCCCCACTGCAGCTCAGCCTGG + Intergenic
1032358418 7:131231161-131231183 TTCTCCTCTCCTGCCCTGCCAGG - Intronic
1032537468 7:132677000-132677022 TCTCACTCTCCTGCCCAGGCTGG + Intronic
1032828150 7:135592841-135592863 TGCCCCTCTGCACTCCAGCCTGG + Intronic
1032830782 7:135623251-135623273 TCTCACTCTGCAGCCCAGGCTGG - Intronic
1033213463 7:139477786-139477808 TCCCGCTCTTTAGCCCAGGCCGG + Intronic
1033316401 7:140301089-140301111 TCCCCCTGTCTTGCCCAGGCTGG + Intronic
1033329678 7:140407648-140407670 TGCACTTCTCCAGCTCAGCCAGG + Exonic
1033522414 7:142174743-142174765 TCTCCCTCTGCTGCCCAGGCTGG + Intronic
1033635609 7:143209126-143209148 TCCCTCTCTCCAGCAAGGCCTGG + Intergenic
1033673522 7:143515295-143515317 TCTGCATCTCCAGCCCAGCAAGG - Intergenic
1033757117 7:144404290-144404312 TCCCCCACTGCACTCCAGCCTGG - Intronic
1034096199 7:148410019-148410041 TCCCGCTCTTTAGCCCAGGCCGG - Intronic
1034179369 7:149126038-149126060 GCACCTTCTCCAGCCCAGCCCGG + Intronic
1034190379 7:149208989-149209011 TCTCCCTCTGTAGCCCAGGCTGG - Intronic
1034204356 7:149302715-149302737 TCTCCCTCTGCCACCCAGCCTGG + Intergenic
1034244755 7:149635925-149635947 ACCCCCTCCCCCGCCCACCCCGG + Intergenic
1034262145 7:149763879-149763901 TGCCCTTCTCCAGCCCACGCAGG - Intergenic
1034352983 7:150429257-150429279 TTCCCTTCTCCAGTGCAGCCAGG + Intergenic
1034408351 7:150921651-150921673 TCTCCCTCTCTTGCCCAGGCTGG - Intergenic
1034412167 7:150947384-150947406 TCCCCCTCTCCAGCCCGGGTCGG - Exonic
1034458987 7:151187618-151187640 GGCCCCACTCCCGCCCAGCCTGG - Intronic
1034478581 7:151303017-151303039 TCTCCCTCTGTCGCCCAGCCTGG + Intergenic
1034832573 7:154322101-154322123 CCCACCTCCTCAGCCCAGCCTGG + Intronic
1034925001 7:155114136-155114158 ACCCCCTCTGCAGGCCAGCTTGG + Intergenic
1034964099 7:155381233-155381255 TCCCCTTCTCCAGCCCCGTGTGG - Intergenic
1035163689 7:156970248-156970270 TCTCACTGTCCAGCCCAGGCTGG - Exonic
1035326585 7:158070087-158070109 TCAGCCTCTCCAGCCCTGCCTGG - Intronic
1036010187 8:4713429-4713451 TCTCCCTCTCTTGCCCAGGCTGG + Intronic
1036359114 8:8065285-8065307 ACCTCCTCCCCACCCCAGCCAGG - Intergenic
1036448436 8:8843549-8843571 TCCCACTCTTTAGCCCAGGCTGG - Intronic
1036658083 8:10690650-10690672 TCCCCGTTTCCAGCCCCGCAGGG + Intronic
1036891844 8:12601667-12601689 ACCTCCTCCCCACCCCAGCCAGG + Intergenic
1036958143 8:13213811-13213833 TCTCCCTCTGTTGCCCAGCCTGG + Intronic
1037794154 8:21977553-21977575 TCTCCCTCTGTAGCCCAGGCTGG - Intronic
1037798487 8:22016977-22016999 TCTCCCTCTGCAGTCCAGGCTGG - Intergenic
1037850786 8:22326145-22326167 TTCCCCTCGCCTTCCCAGCCTGG + Intronic
1038035662 8:23683879-23683901 TCTCCCTCTGCCGCCCAGGCTGG + Intergenic
1038180587 8:25223508-25223530 TCTCGCTCTGCTGCCCAGCCTGG + Intronic
1038265718 8:26038851-26038873 TCTCCCTCCCCAACCCAGTCAGG - Intronic
1038456502 8:27675144-27675166 ACCACCTCTCCAACCCAGGCAGG + Intronic
1038567680 8:28633588-28633610 TGCCCCACTGCAGTCCAGCCTGG + Intronic
1038752028 8:30304750-30304772 TCTCCCTCTCTTGCCCAGGCTGG + Intergenic
1038845800 8:31228683-31228705 TCTCCCTCTCTTGCCCAGGCTGG + Intergenic
1039021448 8:33211578-33211600 TTCCCCTCTCCTGCCCAGAGAGG + Intergenic
1039262542 8:35787645-35787667 TCTCACTCTGCTGCCCAGCCTGG + Intronic
1039434878 8:37553253-37553275 TCCCTCCCACCAGCCCACCCAGG - Intergenic
1039565370 8:38548342-38548364 TCTCCCTCTGTAGCCCAGGCTGG + Intergenic
1039697555 8:39928701-39928723 TCCCGCTCTTTAGCCCAGGCCGG - Intergenic
1040004539 8:42608323-42608345 TCCCGCTCTCTAGCCCAGGCCGG - Intergenic
1040012749 8:42675955-42675977 GCCCCCACTCCATTCCAGCCTGG + Intergenic
1040390877 8:46949579-46949601 TTCCCCTCTCCAGAGCAGCAAGG - Intergenic
1040859338 8:51983223-51983245 TCCACCACTCCACTCCAGCCTGG - Intergenic
1041083850 8:54238937-54238959 TCTCCCTCTGTAGCCCAGGCTGG + Intergenic
1041664625 8:60430598-60430620 TCCCGCTCTTTAGCCCAGGCCGG + Intergenic
1041933653 8:63313441-63313463 TCTGCCTCCCCAGCCCACCCTGG - Intergenic
1042894353 8:73650988-73651010 TGCCCCTGGCCAGCCCTGCCCGG + Intronic
1042922055 8:73929658-73929680 TCTCTCTCTCTAGCCCAGGCTGG - Intergenic
1043061574 8:75511633-75511655 TCGCCCACTGCAGTCCAGCCTGG - Intronic
1043933159 8:86113450-86113472 TCTCCCTCTGTAGCCCAGGCAGG - Intronic
1044658674 8:94574178-94574200 TCTCCCTCTCTTGCCCAGGCTGG - Intergenic
1044689426 8:94861968-94861990 TCCCCCTCTGTCGCCCAGGCTGG + Intronic
1044727831 8:95207633-95207655 TCCCGCTCTTTAGCCCAGGCCGG - Intergenic
1044862308 8:96535031-96535053 TCTCCCTCTCTAGCCCAGGCTGG + Intronic
1045268864 8:100644692-100644714 TCTCCCTCTGTTGCCCAGCCTGG + Intronic
1045480224 8:102586053-102586075 TCTCCCTCTCCTGCCTGGCCTGG - Intergenic
1045500179 8:102738737-102738759 TCGGACTCTCCTGCCCAGCCTGG - Intergenic
1045879480 8:107020954-107020976 TTGGCCCCTCCAGCCCAGCCAGG + Intergenic
1046035194 8:108832428-108832450 TCTCCCTCTGTAGCCCAGACTGG + Intergenic
1046057118 8:109092464-109092486 TCTCCCTCTGTAGCCCAGGCTGG + Intronic
1046423853 8:114020159-114020181 TCTCCCTCTCTTGCCCAGGCTGG + Intergenic
1046600116 8:116306726-116306748 TCCCGCTCTTTAGCCCAGGCCGG + Intergenic
1046773165 8:118136716-118136738 TCCACATCTACAGCTCAGCCAGG - Intergenic
1046797258 8:118386698-118386720 TCCGACTTTCAAGCCCAGCCTGG + Intronic
1047206241 8:122804785-122804807 TGCCCATCTGTAGCCCAGCCGGG + Intronic
1047259478 8:123242898-123242920 TGCGCCTCTGCACCCCAGCCTGG - Intronic
1047480201 8:125274898-125274920 TCTCCCTCTGAAGCCCAGGCTGG - Intronic
1047806962 8:128371003-128371025 TCTCACTCTCCTGCCCAGGCTGG + Intergenic
1048399511 8:134051278-134051300 TCCCCTTCCCCAGAGCAGCCAGG + Intergenic
1048406422 8:134127221-134127243 TCCTCCTCTGCAGTCCAGCGAGG + Intergenic
1048459741 8:134611561-134611583 TCCCCCTCCCCAGGCCTGACTGG - Intronic
1048678469 8:136811995-136812017 TCTCCCTCTGCTGCCCAGGCTGG + Intergenic
1048770885 8:137893459-137893481 TCCTCCTCACCCACCCAGCCAGG - Intergenic
1048847680 8:138615958-138615980 CCCCCAGCCCCAGCCCAGCCAGG + Intronic
1049004289 8:139845015-139845037 GCCCCCTCTCCAGCCCTGCCCGG + Intronic
1049252593 8:141597217-141597239 TCCCTCTCCCCTGCCCAGCTGGG + Intergenic
1049341423 8:142114601-142114623 TCCCACTGACCATCCCAGCCTGG + Intergenic
1049383667 8:142330288-142330310 CCCCGCTCCCCAGCCCAGCCAGG + Intronic
1049406302 8:142453113-142453135 CCCCCCTCGCCGGCCCGGCCCGG + Intronic
1049448111 8:142641012-142641034 TCCCCATCCCCAGCCTGGCCAGG + Intergenic
1049580489 8:143408504-143408526 CCCCGGTCTCCATCCCAGCCAGG - Intergenic
1049803049 8:144527022-144527044 TCCCCCGCCCCCTCCCAGCCCGG - Exonic
1049845717 8:144799908-144799930 TCTCCCTCTGTTGCCCAGCCTGG - Intronic
1050472188 9:6005473-6005495 TCTCCCTCTGTAGCCCAGGCTGG - Intronic
1050495483 9:6236839-6236861 TCTCCCTCTGCTGCCCAGGCTGG - Intronic
1050669347 9:7978806-7978828 TCCCCCTCTGTTGCCCAGGCAGG + Intergenic
1051104918 9:13568665-13568687 GCCCCCTCTGCTGCCCAGCACGG - Intergenic
1051247221 9:15123936-15123958 TCCCACTCTGTAGCCCAGGCTGG - Intergenic
1051556699 9:18391852-18391874 CCTCGCTCTGCAGCCCAGCCTGG + Intergenic
1052337366 9:27333875-27333897 TCCCACTCACCACACCAGCCAGG + Intronic
1052558477 9:30051734-30051756 CCCGCCTCTACACCCCAGCCTGG - Intergenic
1052693517 9:31848095-31848117 TGTCCCTCTCCATCCCACCCAGG + Intergenic
1052868368 9:33480503-33480525 TCTCCCTCTATAGCCCAGGCTGG + Intergenic
1052902955 9:33810230-33810252 TCCTCCTCTGCTGCCCAGGCTGG - Intergenic
1053050045 9:34953890-34953912 TGCGCCTCTCCACTCCAGCCTGG + Intergenic
1053136560 9:35654289-35654311 TCTCCCTCTGCTGCCCAGTCAGG - Intergenic
1053297770 9:36927221-36927243 CACCCCTCCCCAGCCCACCCTGG + Intronic
1053413227 9:37929026-37929048 CCCCCCTCTCCAGCCCTGCCTGG - Intronic
1053506135 9:38645089-38645111 TCTCCCTCTGCGGCCCAGGCTGG + Intergenic
1053800860 9:41763909-41763931 ACCGCCTCTCCTGCCCAGCAGGG + Intergenic
1054144336 9:61550930-61550952 ACCACCTCTCCTGCCCAGCAGGG - Intergenic
1054189291 9:61976059-61976081 ACCGCCTCTCCTGCCCAGCAGGG + Intergenic
1054337374 9:63818334-63818356 CCCCCTGCTCCAGCCCAGCCAGG - Intergenic
1054464024 9:65481889-65481911 ACCACCTCTCCTGCCCAGCAGGG - Intergenic
1054649226 9:67612552-67612574 ACCACCTCTCCTGCCCAGCAGGG - Intergenic
1055857546 9:80708523-80708545 TCTCCCTCTGTCGCCCAGCCTGG - Intergenic
1056348870 9:85727295-85727317 TCCCCCTCTGTTGCCCAGGCTGG - Intronic
1056530750 9:87485425-87485447 TGCACCTCTCCACTCCAGCCTGG - Intergenic
1056659082 9:88531711-88531733 TCTCCCTCTGTTGCCCAGCCTGG - Intergenic
1057054983 9:91953360-91953382 TCTCACTCTGCAGCCCAGGCTGG - Intergenic
1057355648 9:94328815-94328837 TCCCCCACCCCCGCCAAGCCCGG - Intergenic
1057385154 9:94600210-94600232 TGCCACCCTCCAGCCCAGGCTGG + Intergenic
1057652111 9:96928811-96928833 TCCCCCACCCCCGCCAAGCCCGG + Intronic
1057689901 9:97274814-97274836 TCCTCCTCTGCTGCCCAGGCTGG + Intergenic
1057755094 9:97827582-97827604 TCCCGCTCTGCCGCCCAGGCTGG - Intergenic
1057801568 9:98194256-98194278 TCCCACTCTGTAGCCCAGGCTGG - Intergenic
1057840336 9:98481140-98481162 CCCCCAACCCCAGCCCAGCCTGG + Intronic
1057861676 9:98645635-98645657 CCCCATTCTCCAGCCCTGCCTGG + Intronic
1057878290 9:98774183-98774205 TCCACCCCTCCACCCAAGCCGGG + Intronic
1057986019 9:99715027-99715049 TCCCACTCTGTAGCCCAGGCTGG + Intergenic
1058049468 9:100392238-100392260 TCTCCCTCTCTTGCCAAGCCTGG + Intergenic
1058121754 9:101146704-101146726 TCTCCCTCTCACCCCCAGCCAGG + Intronic
1058321055 9:103631332-103631354 TCTCCCTCTCTAGCCCAGGGTGG - Intergenic
1058368457 9:104236029-104236051 TCTCCCTCTCTTGCCAAGCCTGG - Intergenic
1058785852 9:108385946-108385968 TCCCGCTCTTTAGCCCAGGCCGG - Intergenic
1058862688 9:109132015-109132037 TGCCCCTCTGCACTCCAGCCTGG - Exonic
1059126390 9:111690392-111690414 TCTCCCTCTGTAGCCCAGGCTGG - Intronic
1059129310 9:111729143-111729165 TCCTCCTCTGTAGCCCAGGCTGG + Intronic
1059247760 9:112862966-112862988 TCTCTCTCTCCAGCTCATCCTGG + Intronic
1059310191 9:113383307-113383329 TCTCCCTCTGTAGCCCAGGCCGG + Intergenic
1059417461 9:114170791-114170813 TTCACCTCTCCAGCCAACCCAGG + Intronic
1059466294 9:114470811-114470833 TCCCCCGCCCCACCCCACCCCGG + Intronic
1060086191 9:120704288-120704310 TCCGCCACTGCATCCCAGCCTGG + Intronic
1060182855 9:121546042-121546064 TGGCCCTCTCCACCCCCGCCCGG + Intergenic
1060483704 9:124033669-124033691 GCCTTCTTTCCAGCCCAGCCAGG - Intergenic
1060653751 9:125353312-125353334 TCCTCATCTCCACCTCAGCCTGG + Intronic
1060685019 9:125602221-125602243 TCTCCCTCTGCTGCCCAGGCTGG - Intronic
1060736251 9:126068235-126068257 TCTCCCTCTCTCGCCCAGCCTGG + Intergenic
1060813622 9:126623694-126623716 TCCCCCTCCCCACCCCTCCCAGG - Intronic
1060816465 9:126637995-126638017 TCCCGCTCCGCAGCCCTGCCCGG + Intronic
1060907139 9:127316739-127316761 CACCCCTCTCCAGCCCAGGGAGG - Intronic
1061009092 9:127944749-127944771 TCGCCCCCACCAGCCCAGCACGG + Intronic
1061113626 9:128593738-128593760 TCCCCCACCTCACCCCAGCCTGG + Intronic
1061165519 9:128919945-128919967 TCCCCCTCCCCCACCCACCCAGG + Intergenic
1061388263 9:130303116-130303138 TCCTCCTGGGCAGCCCAGCCTGG + Intronic
1061409947 9:130414993-130415015 TGCCCCTCTCCCTCCCAGCCAGG + Intronic
1061451133 9:130667519-130667541 TCCCCCACTCCAGCTCCCCCCGG + Intronic
1061591257 9:131599152-131599174 TCTCCCTCTGTAGCCCAGGCTGG + Intronic
1061628305 9:131855555-131855577 CCCCACTCTCCTTCCCAGCCGGG - Intergenic
1061680366 9:132240088-132240110 TCCCCCAACCCTGCCCAGCCAGG + Intronic
1061943533 9:133895288-133895310 TCCCCGACCCCAGCCCCGCCAGG - Intronic
1061955953 9:133961461-133961483 TCCCCTTCTCCAACCCAGTCGGG + Intronic
1062016638 9:134294433-134294455 GCCACCTCTCCTTCCCAGCCTGG + Intergenic
1062047972 9:134433117-134433139 TGCCCATCTCCATCCCGGCCCGG - Intronic
1062085814 9:134647616-134647638 TCCTCCTCTCCCGTCCAGCTGGG - Intronic
1062260234 9:135658597-135658619 TCTCCCTCTGCCGCCCAGGCTGG - Intergenic
1062279863 9:135747085-135747107 TGCCTCTCTCCCACCCAGCCCGG - Intronic
1062290553 9:135792490-135792512 CCCCACCCTCCAGCACAGCCTGG - Exonic
1062363741 9:136199236-136199258 GCGCCCCCTCCACCCCAGCCCGG - Intronic
1062457882 9:136648195-136648217 TCTCCCTCTGTCGCCCAGCCTGG - Intergenic
1062472426 9:136712405-136712427 GCCCCCTCCTCAGCCGAGCCGGG + Intergenic
1062613124 9:137383834-137383856 CCCCTCCCTCCAGCCCCGCCTGG + Intronic
1203740062 Un_GL000216v2:171107-171129 CCCCGTGCTCCAGCCCAGCCAGG + Intergenic
1203361156 Un_KI270442v1:220063-220085 AGCCCCTCTTCAGCCCAGGCCGG - Intergenic
1203364081 Un_KI270442v1:242760-242782 CCCACCGCTCCAGCCTAGCCAGG + Intergenic
1203377272 Un_KI270442v1:385643-385665 CCCCCTGCTCCAGCCCAGCCAGG - Intergenic
1185536359 X:864561-864583 TCTCGCTCTGCAGCCCAGGCTGG + Intergenic
1185543634 X:924058-924080 TTCTCCTCTCCTGCCCTGCCTGG - Intergenic
1185646831 X:1622020-1622042 TCACTCTGTCCAGCCCAGGCTGG + Intronic
1185776391 X:2806055-2806077 TCTCACTCTGTAGCCCAGCCTGG + Intronic
1185879657 X:3729736-3729758 TCCCCCTCTGTTGCCCAGGCTGG - Intergenic
1186403391 X:9280252-9280274 TCCCCCTGTGCAGCCCAGGGTGG + Intergenic
1186829962 X:13380113-13380135 CACTGCTCTCCAGCCCAGCCTGG + Intergenic
1187274162 X:17803987-17804009 TCCTGCTCTGCAGCCCAGGCTGG + Intronic
1187381610 X:18807057-18807079 TCTCGCTCTGCAGCCCAGGCTGG + Intronic
1187713111 X:22073991-22074013 TCCCCACCTCCACCCCACCCAGG - Intronic
1187875299 X:23798931-23798953 TCCCGCTCTGTTGCCCAGCCTGG + Intergenic
1188054775 X:25528172-25528194 TCTCACTCTGCTGCCCAGCCTGG - Intergenic
1188184498 X:27097513-27097535 TCTCCCTCTACTGCCCAGGCTGG + Intergenic
1188444012 X:30237959-30237981 TCCCGCTCTTTAGCCCAGGCCGG - Intergenic
1188892208 X:35625381-35625403 TCCCCCTCTGTGGCCCAGGCTGG - Intergenic
1189203379 X:39216924-39216946 TCTCCCTCTCTTGCCCAGGCTGG - Intergenic
1189464492 X:41268080-41268102 TCCCACTCTCTCGCCCAGGCTGG - Intergenic
1189498562 X:41531962-41531984 TCCCACTCTGTAGCCCAGGCTGG + Intronic
1189975953 X:46461490-46461512 TGCCCCTCTCCTGCACAGCTGGG + Intronic
1189983114 X:46530210-46530232 TGCCCCTCTCCTGCACAGCTGGG - Intronic
1190287500 X:48971057-48971079 TTCCCCTCTCCAGCCCTACTAGG - Exonic
1190454845 X:50617622-50617644 TCCCCCCCCCCACCCCATCCCGG + Intronic
1192212511 X:69136934-69136956 TCCCCATCCCCAGGCCAGCCCGG + Intergenic
1192234870 X:69289376-69289398 TCCCTCCCTGCAGCCCAGCTTGG + Intergenic
1192407407 X:70900347-70900369 TCTCCCTCTGTAGCCCAGGCTGG - Intronic
1192741886 X:73901135-73901157 TCTCCCTCTGTAGCCCAGGCTGG - Intergenic
1193711662 X:84887422-84887444 TGCCCTTCTCCAGCCAATCCTGG - Intergenic
1194670627 X:96728237-96728259 TCCCACTCTCTCGCCCAGGCTGG + Intronic
1195216369 X:102707695-102707717 TCCCTCTCTCTAGCCCAGGCTGG - Intergenic
1195671641 X:107474879-107474901 TCCCCATCACCAGCCCTGCCAGG - Intergenic
1196102065 X:111856787-111856809 TCTCGCTCTGCTGCCCAGCCTGG - Intronic
1196319961 X:114275068-114275090 TCTCCCTCTGTAGCCCAGGCTGG + Intergenic
1196682578 X:118484020-118484042 TCTCCCTCTGTAGCCCAGGCTGG + Intergenic
1196846702 X:119902089-119902111 TCTCCCTCTGTAGCCCAGGCTGG + Intronic
1196987849 X:121294667-121294689 TCTCCCTCTGCCGCCCAGGCTGG + Intergenic
1197250928 X:124215818-124215840 TCCCTCCCTCCATCCCAGCAGGG - Intronic
1197607262 X:128598440-128598462 TCTCGCTCTCTAGCCCAGGCTGG - Intergenic
1197768195 X:130072450-130072472 GACCCCGCTCCAGCCCTGCCTGG - Intronic
1198055116 X:132986277-132986299 TGCCCCTCCCCAACTCAGCCAGG + Intergenic
1198055584 X:132991481-132991503 TCTCACTCTGCAGCCCAGGCTGG - Intergenic
1198112338 X:133512856-133512878 TGTCCCTCTCCAGCCCAACTTGG - Intergenic
1198253002 X:134899924-134899946 TCTCCCTCTGTAGCCCAGGCTGG - Intronic
1199041709 X:143122034-143122056 TCCCCCTGTCCAGACCATACAGG - Intergenic
1199121572 X:144060816-144060838 CACCCCTCTCCTACCCAGCCTGG - Intergenic
1199179457 X:144836405-144836427 TCCCGCTCTGTTGCCCAGCCTGG + Intergenic
1199662246 X:150063650-150063672 TCCCCCTGCCCACCCCAGACAGG + Intergenic
1200080251 X:153572703-153572725 TGCCCCTCCCCTGCCCAGCCTGG + Intronic
1200128646 X:153829850-153829872 TCCCACGCTCCAGGCCCGCCGGG + Intronic
1200138248 X:153885334-153885356 TCACCCACTCCAGCCCTGACTGG + Intronic
1201077295 Y:10197499-10197521 AGCCCCTCTCCAGCCCCGGCCGG + Intergenic
1201175743 Y:11307561-11307583 CCCCGTGCTCCAGCCCAGCCAGG + Intergenic
1201179709 Y:11332975-11332997 CCCCGTGCTCCAGCCCAGCCAGG + Intergenic
1201293586 Y:12445418-12445440 TCTCACTCTGTAGCCCAGCCTGG - Intergenic
1201294937 Y:12454427-12454449 TCTCCCTCTCTTGCCCAGCCTGG - Intergenic
1201457570 Y:14186586-14186608 TCTCCCTCTGTAGCCCAGGCTGG - Intergenic
1201692308 Y:16780446-16780468 TCTCCCTCTGCTGCCCAGGCTGG + Intergenic
1201772852 Y:17634357-17634379 TCTCCCTCTGCCGCCCAGGCTGG + Intergenic
1201828703 Y:18271629-18271651 TCTCCCTCTGCCGCCCAGGCTGG - Intergenic
1202378249 Y:24256996-24257018 TGCCCCTCCCTACCCCAGCCTGG - Intergenic
1202492533 Y:25413125-25413147 TGCCCCTCCCTACCCCAGCCTGG + Intergenic