ID: 1136910781

View in Genome Browser
Species Human (GRCh38)
Location 16:34142568-34142590
Sequence CCAGCCCAGCCAGGCTGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136910768_1136910781 24 Left 1136910768 16:34142521-34142543 CCACATGGGGCTTTCGTGAGCCA No data
Right 1136910781 16:34142568-34142590 CCAGCCCAGCCAGGCTGCGCAGG No data
1136910773_1136910781 4 Left 1136910773 16:34142541-34142563 CCAGGGAGCAAGGGCCTCTCCCC 0: 1
1: 0
2: 6
3: 35
4: 368
Right 1136910781 16:34142568-34142590 CCAGCCCAGCCAGGCTGCGCAGG No data
1136910774_1136910781 -10 Left 1136910774 16:34142555-34142577 CCTCTCCCCCTCTCCAGCCCAGC 0: 1
1: 3
2: 18
3: 222
4: 1555
Right 1136910781 16:34142568-34142590 CCAGCCCAGCCAGGCTGCGCAGG No data
1136910767_1136910781 25 Left 1136910767 16:34142520-34142542 CCCACATGGGGCTTTCGTGAGCC No data
Right 1136910781 16:34142568-34142590 CCAGCCCAGCCAGGCTGCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136910781 Original CRISPR CCAGCCCAGCCAGGCTGCGC AGG Intergenic
No off target data available for this crispr