ID: 1136912282

View in Genome Browser
Species Human (GRCh38)
Location 16:34154230-34154252
Sequence ACGTGGGTAGTGGGGGGAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136912282_1136912295 12 Left 1136912282 16:34154230-34154252 CCGGCTCCCCCCACTACCCACGT No data
Right 1136912295 16:34154265-34154287 GTTTAGTGAGTCAGTTAGGTGGG No data
1136912282_1136912293 8 Left 1136912282 16:34154230-34154252 CCGGCTCCCCCCACTACCCACGT No data
Right 1136912293 16:34154261-34154283 CTTCGTTTAGTGAGTCAGTTAGG No data
1136912282_1136912294 11 Left 1136912282 16:34154230-34154252 CCGGCTCCCCCCACTACCCACGT No data
Right 1136912294 16:34154264-34154286 CGTTTAGTGAGTCAGTTAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136912282 Original CRISPR ACGTGGGTAGTGGGGGGAGC CGG (reversed) Intergenic
No off target data available for this crispr