ID: 1136912663

View in Genome Browser
Species Human (GRCh38)
Location 16:34157422-34157444
Sequence AATCTATTTTGTGGCCTCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136912663_1136912674 11 Left 1136912663 16:34157422-34157444 CCCTTGAGGCCACAAAATAGATT No data
Right 1136912674 16:34157456-34157478 CTCGACGTTTCCCCGGATGCCGG No data
1136912663_1136912669 4 Left 1136912663 16:34157422-34157444 CCCTTGAGGCCACAAAATAGATT No data
Right 1136912669 16:34157449-34157471 CCCACCCCTCGACGTTTCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136912663 Original CRISPR AATCTATTTTGTGGCCTCAA GGG (reversed) Intergenic
No off target data available for this crispr