ID: 1136913181

View in Genome Browser
Species Human (GRCh38)
Location 16:34160333-34160355
Sequence GGGGGCATGCGATTGGCCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136913181_1136913191 27 Left 1136913181 16:34160333-34160355 CCTCGGGCCAATCGCATGCCCCC No data
Right 1136913191 16:34160383-34160405 TCTGCCCTATCAACTTTCGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136913181 Original CRISPR GGGGGCATGCGATTGGCCCG AGG (reversed) Intergenic
No off target data available for this crispr