ID: 1136913299

View in Genome Browser
Species Human (GRCh38)
Location 16:34161119-34161141
Sequence AACACCGCCACGTTGCCAGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136913299_1136913300 -5 Left 1136913299 16:34161119-34161141 CCGACTGGCAACGTGGCGGTGTT No data
Right 1136913300 16:34161137-34161159 GTGTTATTCCCATGACCCGCTGG No data
1136913299_1136913306 23 Left 1136913299 16:34161119-34161141 CCGACTGGCAACGTGGCGGTGTT No data
Right 1136913306 16:34161165-34161187 TTCCAAGAAACCAAAGTCTTTGG No data
1136913299_1136913301 -4 Left 1136913299 16:34161119-34161141 CCGACTGGCAACGTGGCGGTGTT No data
Right 1136913301 16:34161138-34161160 TGTTATTCCCATGACCCGCTGGG No data
1136913299_1136913307 24 Left 1136913299 16:34161119-34161141 CCGACTGGCAACGTGGCGGTGTT No data
Right 1136913307 16:34161166-34161188 TCCAAGAAACCAAAGTCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136913299 Original CRISPR AACACCGCCACGTTGCCAGT CGG (reversed) Intergenic