ID: 1136913304

View in Genome Browser
Species Human (GRCh38)
Location 16:34161152-34161174
Sequence TTTCTTGGAAGCTGCCCAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136913304_1136913313 7 Left 1136913304 16:34161152-34161174 CCCGCTGGGCAGCTTCCAAGAAA No data
Right 1136913313 16:34161182-34161204 CTTTGGGTTTTTAGGTTCCGGGG No data
1136913304_1136913314 8 Left 1136913304 16:34161152-34161174 CCCGCTGGGCAGCTTCCAAGAAA No data
Right 1136913314 16:34161183-34161205 TTTGGGTTTTTAGGTTCCGGGGG No data
1136913304_1136913316 16 Left 1136913304 16:34161152-34161174 CCCGCTGGGCAGCTTCCAAGAAA No data
Right 1136913316 16:34161191-34161213 TTTAGGTTCCGGGGGGAGTACGG No data
1136913304_1136913311 5 Left 1136913304 16:34161152-34161174 CCCGCTGGGCAGCTTCCAAGAAA No data
Right 1136913311 16:34161180-34161202 GTCTTTGGGTTTTTAGGTTCCGG No data
1136913304_1136913307 -9 Left 1136913304 16:34161152-34161174 CCCGCTGGGCAGCTTCCAAGAAA No data
Right 1136913307 16:34161166-34161188 TCCAAGAAACCAAAGTCTTTGGG No data
1136913304_1136913315 9 Left 1136913304 16:34161152-34161174 CCCGCTGGGCAGCTTCCAAGAAA No data
Right 1136913315 16:34161184-34161206 TTGGGTTTTTAGGTTCCGGGGGG No data
1136913304_1136913306 -10 Left 1136913304 16:34161152-34161174 CCCGCTGGGCAGCTTCCAAGAAA No data
Right 1136913306 16:34161165-34161187 TTCCAAGAAACCAAAGTCTTTGG No data
1136913304_1136913312 6 Left 1136913304 16:34161152-34161174 CCCGCTGGGCAGCTTCCAAGAAA No data
Right 1136913312 16:34161181-34161203 TCTTTGGGTTTTTAGGTTCCGGG No data
1136913304_1136913309 -1 Left 1136913304 16:34161152-34161174 CCCGCTGGGCAGCTTCCAAGAAA No data
Right 1136913309 16:34161174-34161196 ACCAAAGTCTTTGGGTTTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136913304 Original CRISPR TTTCTTGGAAGCTGCCCAGC GGG (reversed) Intergenic