ID: 1136913307

View in Genome Browser
Species Human (GRCh38)
Location 16:34161166-34161188
Sequence TCCAAGAAACCAAAGTCTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136913299_1136913307 24 Left 1136913299 16:34161119-34161141 CCGACTGGCAACGTGGCGGTGTT No data
Right 1136913307 16:34161166-34161188 TCCAAGAAACCAAAGTCTTTGGG No data
1136913305_1136913307 -10 Left 1136913305 16:34161153-34161175 CCGCTGGGCAGCTTCCAAGAAAC No data
Right 1136913307 16:34161166-34161188 TCCAAGAAACCAAAGTCTTTGGG No data
1136913303_1136913307 -3 Left 1136913303 16:34161146-34161168 CCATGACCCGCTGGGCAGCTTCC No data
Right 1136913307 16:34161166-34161188 TCCAAGAAACCAAAGTCTTTGGG No data
1136913304_1136913307 -9 Left 1136913304 16:34161152-34161174 CCCGCTGGGCAGCTTCCAAGAAA No data
Right 1136913307 16:34161166-34161188 TCCAAGAAACCAAAGTCTTTGGG No data
1136913302_1136913307 -2 Left 1136913302 16:34161145-34161167 CCCATGACCCGCTGGGCAGCTTC No data
Right 1136913307 16:34161166-34161188 TCCAAGAAACCAAAGTCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136913307 Original CRISPR TCCAAGAAACCAAAGTCTTT GGG Intergenic