ID: 1136913312

View in Genome Browser
Species Human (GRCh38)
Location 16:34161181-34161203
Sequence TCTTTGGGTTTTTAGGTTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136913308_1136913312 -9 Left 1136913308 16:34161167-34161189 CCAAGAAACCAAAGTCTTTGGGT No data
Right 1136913312 16:34161181-34161203 TCTTTGGGTTTTTAGGTTCCGGG No data
1136913303_1136913312 12 Left 1136913303 16:34161146-34161168 CCATGACCCGCTGGGCAGCTTCC No data
Right 1136913312 16:34161181-34161203 TCTTTGGGTTTTTAGGTTCCGGG No data
1136913304_1136913312 6 Left 1136913304 16:34161152-34161174 CCCGCTGGGCAGCTTCCAAGAAA No data
Right 1136913312 16:34161181-34161203 TCTTTGGGTTTTTAGGTTCCGGG No data
1136913302_1136913312 13 Left 1136913302 16:34161145-34161167 CCCATGACCCGCTGGGCAGCTTC No data
Right 1136913312 16:34161181-34161203 TCTTTGGGTTTTTAGGTTCCGGG No data
1136913305_1136913312 5 Left 1136913305 16:34161153-34161175 CCGCTGGGCAGCTTCCAAGAAAC No data
Right 1136913312 16:34161181-34161203 TCTTTGGGTTTTTAGGTTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136913312 Original CRISPR TCTTTGGGTTTTTAGGTTCC GGG Intergenic