ID: 1136916100

View in Genome Browser
Species Human (GRCh38)
Location 16:34199421-34199443
Sequence ACATAAAAACTACACAGGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136916100_1136916106 13 Left 1136916100 16:34199421-34199443 CCGGCCCTGTGTAGTTTTTATGT No data
Right 1136916106 16:34199457-34199479 TTTCAATAATAGGCCGCTAAGGG No data
1136916100_1136916103 3 Left 1136916100 16:34199421-34199443 CCGGCCCTGTGTAGTTTTTATGT No data
Right 1136916103 16:34199447-34199469 GATATTTCCTTTTCAATAATAGG No data
1136916100_1136916105 12 Left 1136916100 16:34199421-34199443 CCGGCCCTGTGTAGTTTTTATGT No data
Right 1136916105 16:34199456-34199478 TTTTCAATAATAGGCCGCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136916100 Original CRISPR ACATAAAAACTACACAGGGC CGG (reversed) Intergenic
No off target data available for this crispr