ID: 1136920874 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:34272225-34272247 |
| Sequence | GATATTTCCTTTTCTACCTT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1136920874_1136920877 | 30 | Left | 1136920874 | 16:34272225-34272247 | CCAAAGGTAGAAAAGGAAATATC | No data | ||
| Right | 1136920877 | 16:34272278-34272300 | AGTAACTGCGTAGTGATGTGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1136920874 | Original CRISPR | GATATTTCCTTTTCTACCTT TGG (reversed) | Intergenic | ||