ID: 1136920877

View in Genome Browser
Species Human (GRCh38)
Location 16:34272278-34272300
Sequence AGTAACTGCGTAGTGATGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136920874_1136920877 30 Left 1136920874 16:34272225-34272247 CCAAAGGTAGAAAAGGAAATATC No data
Right 1136920877 16:34272278-34272300 AGTAACTGCGTAGTGATGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136920877 Original CRISPR AGTAACTGCGTAGTGATGTG TGG Intergenic