ID: 1136922337

View in Genome Browser
Species Human (GRCh38)
Location 16:34343619-34343641
Sequence TTGTGGCTCTGGGGGTGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136922326_1136922337 10 Left 1136922326 16:34343586-34343608 CCAACATCCTTCTTTGAGTTCTC No data
Right 1136922337 16:34343619-34343641 TTGTGGCTCTGGGGGTGACAAGG No data
1136922330_1136922337 3 Left 1136922330 16:34343593-34343615 CCTTCTTTGAGTTCTCTGGGGAG No data
Right 1136922337 16:34343619-34343641 TTGTGGCTCTGGGGGTGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136922337 Original CRISPR TTGTGGCTCTGGGGGTGACA AGG Intergenic
No off target data available for this crispr