ID: 1136923439

View in Genome Browser
Species Human (GRCh38)
Location 16:34350500-34350522
Sequence CGGGGGAGTCGCGGGGCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136923439_1136923447 5 Left 1136923439 16:34350500-34350522 CCAGGAGCCCCGCGACTCCCCCG No data
Right 1136923447 16:34350528-34350550 AGTTTGCCAAGCGCCAAGTGTGG No data
1136923439_1136923454 29 Left 1136923439 16:34350500-34350522 CCAGGAGCCCCGCGACTCCCCCG No data
Right 1136923454 16:34350552-34350574 AGGCGGGAGCCCAGGCCTCCTGG No data
1136923439_1136923451 13 Left 1136923439 16:34350500-34350522 CCAGGAGCCCCGCGACTCCCCCG No data
Right 1136923451 16:34350536-34350558 AAGCGCCAAGTGTGGCAGGCGGG No data
1136923439_1136923453 21 Left 1136923439 16:34350500-34350522 CCAGGAGCCCCGCGACTCCCCCG No data
Right 1136923453 16:34350544-34350566 AGTGTGGCAGGCGGGAGCCCAGG No data
1136923439_1136923450 12 Left 1136923439 16:34350500-34350522 CCAGGAGCCCCGCGACTCCCCCG No data
Right 1136923450 16:34350535-34350557 CAAGCGCCAAGTGTGGCAGGCGG No data
1136923439_1136923448 9 Left 1136923439 16:34350500-34350522 CCAGGAGCCCCGCGACTCCCCCG No data
Right 1136923448 16:34350532-34350554 TGCCAAGCGCCAAGTGTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136923439 Original CRISPR CGGGGGAGTCGCGGGGCTCC TGG (reversed) Intergenic
No off target data available for this crispr