ID: 1136926448

View in Genome Browser
Species Human (GRCh38)
Location 16:34379737-34379759
Sequence TTTGATAAGTAGAAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136926448_1136926458 22 Left 1136926448 16:34379737-34379759 CCCTCCTCCTTCTACTTATCAAA No data
Right 1136926458 16:34379782-34379804 GCTATTACCAGCGCATTTCAGGG No data
1136926448_1136926457 21 Left 1136926448 16:34379737-34379759 CCCTCCTCCTTCTACTTATCAAA No data
Right 1136926457 16:34379781-34379803 TGCTATTACCAGCGCATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136926448 Original CRISPR TTTGATAAGTAGAAGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr