ID: 1136931969

View in Genome Browser
Species Human (GRCh38)
Location 16:34426792-34426814
Sequence ATGCACATCCAGAAGAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136931967_1136931969 1 Left 1136931967 16:34426768-34426790 CCATACAAACAGACCAAACAAAT No data
Right 1136931969 16:34426792-34426814 ATGCACATCCAGAAGAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136931969 Original CRISPR ATGCACATCCAGAAGAGTGA AGG Intergenic
No off target data available for this crispr