ID: 1136932547

View in Genome Browser
Species Human (GRCh38)
Location 16:34432292-34432314
Sequence GAGAGAGGAGAGAGAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136932547_1136932553 17 Left 1136932547 16:34432292-34432314 CCTTCCTCTCTCTCTCCTCTCTC No data
Right 1136932553 16:34432332-34432354 GCCCATGTGCGTGTGTGTTTTGG No data
1136932547_1136932555 18 Left 1136932547 16:34432292-34432314 CCTTCCTCTCTCTCTCCTCTCTC No data
Right 1136932555 16:34432333-34432355 CCCATGTGCGTGTGTGTTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136932547 Original CRISPR GAGAGAGGAGAGAGAGAGGA AGG (reversed) Intergenic
No off target data available for this crispr