ID: 1136932551

View in Genome Browser
Species Human (GRCh38)
Location 16:34432314-34432336
Sequence TGGGCACACACAGCCACAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136932551_1136932553 -5 Left 1136932551 16:34432314-34432336 CCCTCTGTGGCTGTGTGTGCCCA No data
Right 1136932553 16:34432332-34432354 GCCCATGTGCGTGTGTGTTTTGG No data
1136932551_1136932555 -4 Left 1136932551 16:34432314-34432336 CCCTCTGTGGCTGTGTGTGCCCA No data
Right 1136932555 16:34432333-34432355 CCCATGTGCGTGTGTGTTTTGGG No data
1136932551_1136932557 18 Left 1136932551 16:34432314-34432336 CCCTCTGTGGCTGTGTGTGCCCA No data
Right 1136932557 16:34432355-34432377 GATGAATGTGCCCTGTGCGCTGG No data
1136932551_1136932558 21 Left 1136932551 16:34432314-34432336 CCCTCTGTGGCTGTGTGTGCCCA No data
Right 1136932558 16:34432358-34432380 GAATGTGCCCTGTGCGCTGGAGG No data
1136932551_1136932559 22 Left 1136932551 16:34432314-34432336 CCCTCTGTGGCTGTGTGTGCCCA No data
Right 1136932559 16:34432359-34432381 AATGTGCCCTGTGCGCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136932551 Original CRISPR TGGGCACACACAGCCACAGA GGG (reversed) Intergenic
No off target data available for this crispr