ID: 1136932553

View in Genome Browser
Species Human (GRCh38)
Location 16:34432332-34432354
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136932551_1136932553 -5 Left 1136932551 16:34432314-34432336 CCCTCTGTGGCTGTGTGTGCCCA No data
Right 1136932553 16:34432332-34432354 GCCCATGTGCGTGTGTGTTTTGG No data
1136932548_1136932553 13 Left 1136932548 16:34432296-34432318 CCTCTCTCTCTCCTCTCTCCCTC No data
Right 1136932553 16:34432332-34432354 GCCCATGTGCGTGTGTGTTTTGG No data
1136932547_1136932553 17 Left 1136932547 16:34432292-34432314 CCTTCCTCTCTCTCTCCTCTCTC No data
Right 1136932553 16:34432332-34432354 GCCCATGTGCGTGTGTGTTTTGG No data
1136932550_1136932553 2 Left 1136932550 16:34432307-34432329 CCTCTCTCCCTCTGTGGCTGTGT No data
Right 1136932553 16:34432332-34432354 GCCCATGTGCGTGTGTGTTTTGG No data
1136932552_1136932553 -6 Left 1136932552 16:34432315-34432337 CCTCTGTGGCTGTGTGTGCCCAT No data
Right 1136932553 16:34432332-34432354 GCCCATGTGCGTGTGTGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136932553 Original CRISPR GCCCATGTGCGTGTGTGTTT TGG Intergenic
No off target data available for this crispr