ID: 1136932559

View in Genome Browser
Species Human (GRCh38)
Location 16:34432359-34432381
Sequence AATGTGCCCTGTGCGCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136932551_1136932559 22 Left 1136932551 16:34432314-34432336 CCCTCTGTGGCTGTGTGTGCCCA No data
Right 1136932559 16:34432359-34432381 AATGTGCCCTGTGCGCTGGAGGG No data
1136932552_1136932559 21 Left 1136932552 16:34432315-34432337 CCTCTGTGGCTGTGTGTGCCCAT No data
Right 1136932559 16:34432359-34432381 AATGTGCCCTGTGCGCTGGAGGG No data
1136932554_1136932559 3 Left 1136932554 16:34432333-34432355 CCCATGTGCGTGTGTGTTTTGGG No data
Right 1136932559 16:34432359-34432381 AATGTGCCCTGTGCGCTGGAGGG No data
1136932550_1136932559 29 Left 1136932550 16:34432307-34432329 CCTCTCTCCCTCTGTGGCTGTGT No data
Right 1136932559 16:34432359-34432381 AATGTGCCCTGTGCGCTGGAGGG No data
1136932556_1136932559 2 Left 1136932556 16:34432334-34432356 CCATGTGCGTGTGTGTTTTGGGA No data
Right 1136932559 16:34432359-34432381 AATGTGCCCTGTGCGCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136932559 Original CRISPR AATGTGCCCTGTGCGCTGGA GGG Intergenic
No off target data available for this crispr