ID: 1136934214

View in Genome Browser
Species Human (GRCh38)
Location 16:34443890-34443912
Sequence GCCCATGAAGACGGGTATAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136934214_1136934221 17 Left 1136934214 16:34443890-34443912 CCTATATACCCGTCTTCATGGGC No data
Right 1136934221 16:34443930-34443952 GCCTGAGGGCAGAAGAGATGTGG No data
1136934214_1136934218 2 Left 1136934214 16:34443890-34443912 CCTATATACCCGTCTTCATGGGC No data
Right 1136934218 16:34443915-34443937 TTCCACTGTGACTCTGCCTGAGG No data
1136934214_1136934219 3 Left 1136934214 16:34443890-34443912 CCTATATACCCGTCTTCATGGGC No data
Right 1136934219 16:34443916-34443938 TCCACTGTGACTCTGCCTGAGGG No data
1136934214_1136934226 30 Left 1136934214 16:34443890-34443912 CCTATATACCCGTCTTCATGGGC No data
Right 1136934226 16:34443943-34443965 AGAGATGTGGGTGTGGACATGGG No data
1136934214_1136934223 18 Left 1136934214 16:34443890-34443912 CCTATATACCCGTCTTCATGGGC No data
Right 1136934223 16:34443931-34443953 CCTGAGGGCAGAAGAGATGTGGG No data
1136934214_1136934225 29 Left 1136934214 16:34443890-34443912 CCTATATACCCGTCTTCATGGGC No data
Right 1136934225 16:34443942-34443964 AAGAGATGTGGGTGTGGACATGG No data
1136934214_1136934224 23 Left 1136934214 16:34443890-34443912 CCTATATACCCGTCTTCATGGGC No data
Right 1136934224 16:34443936-34443958 GGGCAGAAGAGATGTGGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136934214 Original CRISPR GCCCATGAAGACGGGTATAT AGG (reversed) Intergenic
No off target data available for this crispr