ID: 1136938754

View in Genome Browser
Species Human (GRCh38)
Location 16:34500463-34500485
Sequence CTGCAAAAAGCAGCGGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136938749_1136938754 5 Left 1136938749 16:34500435-34500457 CCATGGCGGTGGGGATAAAAAGC No data
Right 1136938754 16:34500463-34500485 CTGCAAAAAGCAGCGGTGGTGGG No data
1136938746_1136938754 14 Left 1136938746 16:34500426-34500448 CCCAAAAAGCCATGGCGGTGGGG No data
Right 1136938754 16:34500463-34500485 CTGCAAAAAGCAGCGGTGGTGGG No data
1136938748_1136938754 13 Left 1136938748 16:34500427-34500449 CCAAAAAGCCATGGCGGTGGGGA No data
Right 1136938754 16:34500463-34500485 CTGCAAAAAGCAGCGGTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136938754 Original CRISPR CTGCAAAAAGCAGCGGTGGT GGG Intergenic
No off target data available for this crispr