ID: 1136958007

View in Genome Browser
Species Human (GRCh38)
Location 16:34806223-34806245
Sequence TTCTGCCGCGTGGCTGCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136958001_1136958007 21 Left 1136958001 16:34806179-34806201 CCTCAAATATGATGAGGTAAGCT No data
Right 1136958007 16:34806223-34806245 TTCTGCCGCGTGGCTGCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136958007 Original CRISPR TTCTGCCGCGTGGCTGCTGG AGG Intergenic