ID: 1136961065

View in Genome Browser
Species Human (GRCh38)
Location 16:34848093-34848115
Sequence CTGCAAAAAGCAGCGGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136961065_1136961073 14 Left 1136961065 16:34848093-34848115 CCCACCACCGCTGCTTTTTGCAG No data
Right 1136961073 16:34848130-34848152 CCCCACCGCCATGGCTTTTTGGG No data
1136961065_1136961070 5 Left 1136961065 16:34848093-34848115 CCCACCACCGCTGCTTTTTGCAG No data
Right 1136961070 16:34848121-34848143 GCTTTTTATCCCCACCGCCATGG No data
1136961065_1136961071 13 Left 1136961065 16:34848093-34848115 CCCACCACCGCTGCTTTTTGCAG No data
Right 1136961071 16:34848129-34848151 TCCCCACCGCCATGGCTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136961065 Original CRISPR CTGCAAAAAGCAGCGGTGGT GGG (reversed) Intergenic
No off target data available for this crispr