ID: 1136972022

View in Genome Browser
Species Human (GRCh38)
Location 16:34979507-34979529
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136972017_1136972022 3 Left 1136972017 16:34979481-34979503 CCCAAAACACACACGCACATGGG No data
Right 1136972022 16:34979507-34979529 ACACAGCCACAGAGGGAGAGAGG No data
1136972015_1136972022 25 Left 1136972015 16:34979459-34979481 CCAGCGCACAGGGCACATTCATC No data
Right 1136972022 16:34979507-34979529 ACACAGCCACAGAGGGAGAGAGG No data
1136972019_1136972022 2 Left 1136972019 16:34979482-34979504 CCAAAACACACACGCACATGGGC No data
Right 1136972022 16:34979507-34979529 ACACAGCCACAGAGGGAGAGAGG No data
1136972014_1136972022 28 Left 1136972014 16:34979456-34979478 CCTCCAGCGCACAGGGCACATTC No data
Right 1136972022 16:34979507-34979529 ACACAGCCACAGAGGGAGAGAGG No data
1136972013_1136972022 29 Left 1136972013 16:34979455-34979477 CCCTCCAGCGCACAGGGCACATT No data
Right 1136972022 16:34979507-34979529 ACACAGCCACAGAGGGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136972022 Original CRISPR ACACAGCCACAGAGGGAGAG AGG Intergenic
No off target data available for this crispr