ID: 1136972603

View in Genome Browser
Species Human (GRCh38)
Location 16:34985023-34985045
Sequence ATGCACATCCAGAAGAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136972603_1136972605 1 Left 1136972603 16:34985023-34985045 CCTTCACTCTTCTGGATGTGCAT No data
Right 1136972605 16:34985047-34985069 ATTTGTTTGGTCTGTTTGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136972603 Original CRISPR ATGCACATCCAGAAGAGTGA AGG (reversed) Intergenic
No off target data available for this crispr