ID: 1136978126

View in Genome Browser
Species Human (GRCh38)
Location 16:35032070-35032092
Sequence TTTGATAAGTAGAAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136978116_1136978126 22 Left 1136978116 16:35032025-35032047 CCCTGAAATGCGCTGGTAATAGC No data
Right 1136978126 16:35032070-35032092 TTTGATAAGTAGAAGGAGGAGGG No data
1136978117_1136978126 21 Left 1136978117 16:35032026-35032048 CCTGAAATGCGCTGGTAATAGCA No data
Right 1136978126 16:35032070-35032092 TTTGATAAGTAGAAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136978126 Original CRISPR TTTGATAAGTAGAAGGAGGA GGG Intergenic
No off target data available for this crispr