ID: 1136981134

View in Genome Browser
Species Human (GRCh38)
Location 16:35061306-35061328
Sequence CGGGGGAGTCGCGGGGCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136981120_1136981134 21 Left 1136981120 16:35061262-35061284 CCTGGGCTCCCGCCTGCCACACT No data
Right 1136981134 16:35061306-35061328 CGGGGGAGTCGCGGGGCTCCTGG No data
1136981119_1136981134 29 Left 1136981119 16:35061254-35061276 CCAGGAGGCCTGGGCTCCCGCCT No data
Right 1136981134 16:35061306-35061328 CGGGGGAGTCGCGGGGCTCCTGG No data
1136981126_1136981134 5 Left 1136981126 16:35061278-35061300 CCACACTTGGCGCTTGGCAAACT No data
Right 1136981134 16:35061306-35061328 CGGGGGAGTCGCGGGGCTCCTGG No data
1136981125_1136981134 9 Left 1136981125 16:35061274-35061296 CCTGCCACACTTGGCGCTTGGCA No data
Right 1136981134 16:35061306-35061328 CGGGGGAGTCGCGGGGCTCCTGG No data
1136981123_1136981134 12 Left 1136981123 16:35061271-35061293 CCGCCTGCCACACTTGGCGCTTG No data
Right 1136981134 16:35061306-35061328 CGGGGGAGTCGCGGGGCTCCTGG No data
1136981122_1136981134 13 Left 1136981122 16:35061270-35061292 CCCGCCTGCCACACTTGGCGCTT No data
Right 1136981134 16:35061306-35061328 CGGGGGAGTCGCGGGGCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136981134 Original CRISPR CGGGGGAGTCGCGGGGCTCC TGG Intergenic
No off target data available for this crispr