ID: 1136986711

View in Genome Browser
Species Human (GRCh38)
Location 16:35113089-35113111
Sequence CTTCTCCCCCAGTAGTAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136986711_1136986715 18 Left 1136986711 16:35113089-35113111 CCTCTCTACTACTGGGGGAGAAG No data
Right 1136986715 16:35113130-35113152 CCTGCATTGCATCTACAGGACGG No data
1136986711_1136986717 23 Left 1136986711 16:35113089-35113111 CCTCTCTACTACTGGGGGAGAAG No data
Right 1136986717 16:35113135-35113157 ATTGCATCTACAGGACGGGCAGG No data
1136986711_1136986712 14 Left 1136986711 16:35113089-35113111 CCTCTCTACTACTGGGGGAGAAG No data
Right 1136986712 16:35113126-35113148 TGTCCCTGCATTGCATCTACAGG No data
1136986711_1136986716 19 Left 1136986711 16:35113089-35113111 CCTCTCTACTACTGGGGGAGAAG No data
Right 1136986716 16:35113131-35113153 CTGCATTGCATCTACAGGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136986711 Original CRISPR CTTCTCCCCCAGTAGTAGAG AGG (reversed) Intergenic
No off target data available for this crispr