ID: 1136986712

View in Genome Browser
Species Human (GRCh38)
Location 16:35113126-35113148
Sequence TGTCCCTGCATTGCATCTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136986711_1136986712 14 Left 1136986711 16:35113089-35113111 CCTCTCTACTACTGGGGGAGAAG No data
Right 1136986712 16:35113126-35113148 TGTCCCTGCATTGCATCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136986712 Original CRISPR TGTCCCTGCATTGCATCTAC AGG Intergenic
No off target data available for this crispr