ID: 1136987444

View in Genome Browser
Species Human (GRCh38)
Location 16:35122420-35122442
Sequence TGTATTAAGAAGGAAATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136987440_1136987444 30 Left 1136987440 16:35122367-35122389 CCTGTGCATCAGAGTAACAGAAA No data
Right 1136987444 16:35122420-35122442 TGTATTAAGAAGGAAATGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136987444 Original CRISPR TGTATTAAGAAGGAAATGGA GGG Intergenic
No off target data available for this crispr