ID: 1136988825

View in Genome Browser
Species Human (GRCh38)
Location 16:35139775-35139797
Sequence CGGGGTCCAATGGGTGTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136988812_1136988825 14 Left 1136988812 16:35139738-35139760 CCCTGTGAGAGGCCAGGTGTGGG No data
Right 1136988825 16:35139775-35139797 CGGGGTCCAATGGGTGTTCCTGG No data
1136988819_1136988825 -9 Left 1136988819 16:35139761-35139783 CCACGCATCCAGCCCGGGGTCCA No data
Right 1136988825 16:35139775-35139797 CGGGGTCCAATGGGTGTTCCTGG No data
1136988814_1136988825 13 Left 1136988814 16:35139739-35139761 CCTGTGAGAGGCCAGGTGTGGGC No data
Right 1136988825 16:35139775-35139797 CGGGGTCCAATGGGTGTTCCTGG No data
1136988815_1136988825 2 Left 1136988815 16:35139750-35139772 CCAGGTGTGGGCCACGCATCCAG No data
Right 1136988825 16:35139775-35139797 CGGGGTCCAATGGGTGTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136988825 Original CRISPR CGGGGTCCAATGGGTGTTCC TGG Intergenic
No off target data available for this crispr