ID: 1136990166

View in Genome Browser
Species Human (GRCh38)
Location 16:35147174-35147196
Sequence TCTGGGGCCCCAGGGGATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136990166_1136990175 -4 Left 1136990166 16:35147174-35147196 CCCTGATCCCCTGGGGCCCCAGA No data
Right 1136990175 16:35147193-35147215 CAGAGAGCAGCCTACGGCCCTGG No data
1136990166_1136990177 5 Left 1136990166 16:35147174-35147196 CCCTGATCCCCTGGGGCCCCAGA No data
Right 1136990177 16:35147202-35147224 GCCTACGGCCCTGGGTTCTGTGG No data
1136990166_1136990171 -10 Left 1136990166 16:35147174-35147196 CCCTGATCCCCTGGGGCCCCAGA No data
Right 1136990171 16:35147187-35147209 GGGCCCCAGAGAGCAGCCTACGG No data
1136990166_1136990176 -3 Left 1136990166 16:35147174-35147196 CCCTGATCCCCTGGGGCCCCAGA No data
Right 1136990176 16:35147194-35147216 AGAGAGCAGCCTACGGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136990166 Original CRISPR TCTGGGGCCCCAGGGGATCA GGG (reversed) Intergenic
No off target data available for this crispr