ID: 1136993286

View in Genome Browser
Species Human (GRCh38)
Location 16:35170253-35170275
Sequence CGGGGTCCCGGGCCCCGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136993286_1136993304 21 Left 1136993286 16:35170253-35170275 CCGCCGCGGGGCCCGGGACCCCG No data
Right 1136993304 16:35170297-35170319 GCCCGCGTCGCCTCCGCTCCTGG No data
1136993286_1136993306 22 Left 1136993286 16:35170253-35170275 CCGCCGCGGGGCCCGGGACCCCG No data
Right 1136993306 16:35170298-35170320 CCCGCGTCGCCTCCGCTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136993286 Original CRISPR CGGGGTCCCGGGCCCCGCGG CGG (reversed) Intergenic