ID: 1136993304

View in Genome Browser
Species Human (GRCh38)
Location 16:35170297-35170319
Sequence GCCCGCGTCGCCTCCGCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136993291_1136993304 9 Left 1136993291 16:35170265-35170287 CCGGGACCCCGGCCACCCGGCCC No data
Right 1136993304 16:35170297-35170319 GCCCGCGTCGCCTCCGCTCCTGG No data
1136993288_1136993304 18 Left 1136993288 16:35170256-35170278 CCGCGGGGCCCGGGACCCCGGCC No data
Right 1136993304 16:35170297-35170319 GCCCGCGTCGCCTCCGCTCCTGG No data
1136993296_1136993304 -6 Left 1136993296 16:35170280-35170302 CCCGGCCCCCAGCCGCCGCCCGC No data
Right 1136993304 16:35170297-35170319 GCCCGCGTCGCCTCCGCTCCTGG No data
1136993294_1136993304 1 Left 1136993294 16:35170273-35170295 CCGGCCACCCGGCCCCCAGCCGC No data
Right 1136993304 16:35170297-35170319 GCCCGCGTCGCCTCCGCTCCTGG No data
1136993293_1136993304 2 Left 1136993293 16:35170272-35170294 CCCGGCCACCCGGCCCCCAGCCG No data
Right 1136993304 16:35170297-35170319 GCCCGCGTCGCCTCCGCTCCTGG No data
1136993295_1136993304 -3 Left 1136993295 16:35170277-35170299 CCACCCGGCCCCCAGCCGCCGCC No data
Right 1136993304 16:35170297-35170319 GCCCGCGTCGCCTCCGCTCCTGG No data
1136993292_1136993304 3 Left 1136993292 16:35170271-35170293 CCCCGGCCACCCGGCCCCCAGCC No data
Right 1136993304 16:35170297-35170319 GCCCGCGTCGCCTCCGCTCCTGG No data
1136993297_1136993304 -7 Left 1136993297 16:35170281-35170303 CCGGCCCCCAGCCGCCGCCCGCG No data
Right 1136993304 16:35170297-35170319 GCCCGCGTCGCCTCCGCTCCTGG No data
1136993284_1136993304 27 Left 1136993284 16:35170247-35170269 CCGCTGCCGCCGCGGGGCCCGGG No data
Right 1136993304 16:35170297-35170319 GCCCGCGTCGCCTCCGCTCCTGG No data
1136993290_1136993304 10 Left 1136993290 16:35170264-35170286 CCCGGGACCCCGGCCACCCGGCC No data
Right 1136993304 16:35170297-35170319 GCCCGCGTCGCCTCCGCTCCTGG No data
1136993286_1136993304 21 Left 1136993286 16:35170253-35170275 CCGCCGCGGGGCCCGGGACCCCG No data
Right 1136993304 16:35170297-35170319 GCCCGCGTCGCCTCCGCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136993304 Original CRISPR GCCCGCGTCGCCTCCGCTCC TGG Intergenic