ID: 1136993590

View in Genome Browser
Species Human (GRCh38)
Location 16:35172679-35172701
Sequence GGAGGGGCAGGAAACTTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136993583_1136993590 27 Left 1136993583 16:35172629-35172651 CCACTGGGGGAGGGACAGGAATG No data
Right 1136993590 16:35172679-35172701 GGAGGGGCAGGAAACTTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136993590 Original CRISPR GGAGGGGCAGGAAACTTTGA AGG Intergenic
No off target data available for this crispr