ID: 1136993596

View in Genome Browser
Species Human (GRCh38)
Location 16:35172717-35172739
Sequence CACACTCAGCACTGTGAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136993596_1136993601 30 Left 1136993596 16:35172717-35172739 CCCAGTTCACAGTGCTGAGTGTG No data
Right 1136993601 16:35172770-35172792 ATTCCCTCACCCCTGCCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136993596 Original CRISPR CACACTCAGCACTGTGAACT GGG (reversed) Intergenic
No off target data available for this crispr