ID: 1136994301

View in Genome Browser
Species Human (GRCh38)
Location 16:35177693-35177715
Sequence GCACCTTGTGGGCCACGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136994295_1136994301 -7 Left 1136994295 16:35177677-35177699 CCATACTGGGCCACATGCACCTT No data
Right 1136994301 16:35177693-35177715 GCACCTTGTGGGCCACGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136994301 Original CRISPR GCACCTTGTGGGCCACGGGC TGG Intergenic
No off target data available for this crispr