ID: 1137001225

View in Genome Browser
Species Human (GRCh38)
Location 16:35232789-35232811
Sequence ACTGCTGGTGCCACAGCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137001222_1137001225 -1 Left 1137001222 16:35232767-35232789 CCATACTCCATGAGCAGGCTCTA No data
Right 1137001225 16:35232789-35232811 ACTGCTGGTGCCACAGCTCCAGG No data
1137001223_1137001225 -8 Left 1137001223 16:35232774-35232796 CCATGAGCAGGCTCTACTGCTGG No data
Right 1137001225 16:35232789-35232811 ACTGCTGGTGCCACAGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137001225 Original CRISPR ACTGCTGGTGCCACAGCTCC AGG Intergenic
No off target data available for this crispr